Transcript: Human XM_024447622.1

PREDICTED: Homo sapiens DENN domain containing 1A (DENND1A), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DENND1A (57706)
Length:
5173
CDS:
277..3399

Additional Resources:

NCBI RefSeq record:
XM_024447622.1
NBCI Gene record:
DENND1A (57706)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447622.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249257 ATTCGGGTTCTGCCGCTTATC pLKO_005 435 CDS 100% 10.800 15.120 N Dennd1a n/a
2 TRCN0000350941 ATTCGGGTTCTGCCGCTTATC pLKO_005 435 CDS 100% 10.800 15.120 N DENND1A n/a
3 TRCN0000142109 GAACGCCGGATACTCATCATT pLKO.1 766 CDS 100% 5.625 7.875 N DENND1A n/a
4 TRCN0000141851 GATCTTCTCAATTCCGGCGAA pLKO.1 1303 CDS 100% 2.160 3.024 N DENND1A n/a
5 TRCN0000249253 TACCTCATAGGAATCCATTTA pLKO_005 919 CDS 100% 0.000 0.000 N Dennd1a n/a
6 TRCN0000338586 TACCTCATAGGAATCCATTTA pLKO_005 919 CDS 100% 0.000 0.000 N DENND1A n/a
7 TRCN0000144938 GAAGTGGAGCAATTCTGAATA pLKO.1 1418 CDS 100% 13.200 9.240 N DENND1A n/a
8 TRCN0000143383 GCTTAACATCCTGGCAGATTA pLKO.1 522 CDS 100% 13.200 9.240 N DENND1A n/a
9 TRCN0000201104 CCAGCATACCTGAGAATAGAA pLKO.1 677 CDS 100% 5.625 3.938 N Dennd1a n/a
10 TRCN0000141720 GTTGCATCTGTACGCCAGTAT pLKO.1 738 CDS 100% 4.950 3.465 N DENND1A n/a
11 TRCN0000338625 GTTGCATCTGTACGCCAGTAT pLKO_005 738 CDS 100% 4.950 3.465 N DENND1A n/a
12 TRCN0000122398 GACTGTCTACAAGTTCGCAAA pLKO.1 1470 CDS 100% 4.050 2.835 N DENND1A n/a
13 TRCN0000141749 GCAAACAGAGATTCGGGTTCT pLKO.1 425 CDS 100% 4.050 2.835 N DENND1A n/a
14 TRCN0000141748 GATCCTGAATGTGGACACCAA pLKO.1 984 CDS 100% 2.640 1.848 N DENND1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447622.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03844 pDONR223 100% 48% 45.2% None (many diffs) n/a
2 ccsbBroad304_03844 pLX_304 0% 48% 45.2% V5 (many diffs) n/a
3 TRCN0000481037 TATGGCCGATTTACATGACTCTCC pLX_317 25.9% 48% 45.2% V5 (many diffs) n/a
Download CSV