Transcript: Human XM_024447633.1

PREDICTED: Homo sapiens regulatory factor X3 (RFX3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RFX3 (5991)
Length:
8991
CDS:
9..2246

Additional Resources:

NCBI RefSeq record:
XM_024447633.1
NBCI Gene record:
RFX3 (5991)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447633.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232129 TCTACTCTACGACGAATATAT pLKO_005 1814 CDS 100% 15.000 21.000 N RFX3 n/a
2 TRCN0000014875 GCGAAGATACACGTCGCTTAA pLKO.1 1421 CDS 100% 10.800 15.120 N RFX3 n/a
3 TRCN0000232128 GCGAAGATACACGTCGCTTAA pLKO_005 1421 CDS 100% 10.800 15.120 N RFX3 n/a
4 TRCN0000014874 CCGAACAACAACGTATCCTTA pLKO.1 224 CDS 100% 4.950 6.930 N RFX3 n/a
5 TRCN0000232127 GACCCAAGCCATTCGAAATTT pLKO_005 1298 CDS 100% 15.000 10.500 N RFX3 n/a
6 TRCN0000429600 GACCCAAGCCATTCGAAATTT pLKO_005 1298 CDS 100% 15.000 10.500 N Rfx3 n/a
7 TRCN0000431736 TTGGCAGCAGATGCATCAAAT pLKO_005 2682 3UTR 100% 13.200 9.240 N Rfx3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447633.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01393 pDONR223 100% 94% 94% None 474_475ins75;1894_1956del n/a
2 ccsbBroad304_01393 pLX_304 0% 94% 94% V5 474_475ins75;1894_1956del n/a
3 ccsbBroadEn_11098 pDONR223 100% 49.8% 48.3% None (many diffs) n/a
4 ccsbBroad304_11098 pLX_304 0% 49.8% 48.3% V5 (many diffs) n/a
5 TRCN0000481511 AACTACTTAATTAAATATAGCAAC pLX_317 36.4% 49.8% 48.3% V5 (many diffs) n/a
Download CSV