Transcript: Human XM_024447658.1

PREDICTED: Homo sapiens transforming growth factor beta receptor 1 (TGFBR1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TGFBR1 (7046)
Length:
5765
CDS:
3507..4811

Additional Resources:

NCBI RefSeq record:
XM_024447658.1
NBCI Gene record:
TGFBR1 (7046)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447658.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221535 GCCTTGAGAGTAATGGCTAAA pLKO.1 4686 CDS 100% 10.800 15.120 N TGFBR1 n/a
2 TRCN0000221534 GCGAGAACTATTGTGTTACAA pLKO.1 3903 CDS 100% 5.625 7.875 N TGFBR1 n/a
3 TRCN0000221537 CGATGTTCCATTGGTGGAATT pLKO.1 4539 CDS 100% 0.000 0.000 N TGFBR1 n/a
4 TRCN0000221533 GCTGGTCTTAACTTTAGGTAA pLKO.1 5094 3UTR 100% 4.950 3.960 N TGFBR1 n/a
5 TRCN0000195626 CCCTTCATTAGATCGCCCTTT pLKO.1 3788 CDS 100% 4.050 3.240 N TGFBR1 n/a
6 TRCN0000194693 CTCATGTTGATGGTCTATATC pLKO.1 3720 CDS 100% 13.200 9.240 N TGFBR1 n/a
7 TRCN0000196293 GAAGTTGCTGTTAAGATATTC pLKO.1 3981 CDS 100% 13.200 9.240 N TGFBR1 n/a
8 TRCN0000221536 GCCACAGATACCATTGATATT pLKO.1 4380 CDS 100% 13.200 9.240 N TGFBR1 n/a
9 TRCN0000195087 CCAACTACTGTAAAGTCATCA pLKO.1 3633 CDS 100% 4.950 3.465 N TGFBR1 n/a
10 TRCN0000010441 CACAACAGCATGTGTATAGCT pLKO.1 3498 5UTR 100% 3.000 2.100 N TGFBR1 n/a
11 TRCN0000010442 GAATGTTGGTATGCCAATGGA pLKO.1 4716 CDS 100% 3.000 2.100 N TGFBR1 n/a
12 TRCN0000010443 CAGTAAGTGCCACTTCTGTGT pLKO.1 5452 3UTR 100% 2.640 1.848 N TGFBR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447658.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488036 ATTCCCATATCGAACTAAAGTGCA pLX_317 22.1% 86.2% 86.2% V5 (not translated due to prior stop codon) 0_1ins207 n/a
2 ccsbBroadEn_14861 pDONR223 100% 85.3% 30% None (many diffs) n/a
3 ccsbBroad304_14861 pLX_304 24.6% 85.3% 30% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000468797 GAGGTCCGTGGCCTGTTCCTGGGA pLX_317 25.8% 85.3% 30% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_01666 pDONR223 100% 70.9% 70.9% None 0_1ins207;136_366del n/a
6 ccsbBroad304_01666 pLX_304 52.7% 70.9% 70.9% V5 0_1ins207;136_366del n/a
7 TRCN0000481423 ACACATGTGATGGCATCCCATCCC pLX_317 38.9% 70.9% 70.9% V5 0_1ins207;136_366del n/a
Download CSV