Construct: ORF TRCN0000488036
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020721.1_s317c1
- DNA Barcode:
- ATTCCCATATCGAACTAAAGTGCA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- TGFBR1 (7046)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488036
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 7046 | TGFBR1 | transforming growth factor ... | NM_004612.4 | 100% | 100% | |
2 | human | 7046 | TGFBR1 | transforming growth factor ... | NM_001306210.2 | 99.2% | 99.2% | 343_354del |
3 | human | 7046 | TGFBR1 | transforming growth factor ... | XM_011518949.2 | 86.2% | 86.2% | 0_1ins207 |
4 | human | 7046 | TGFBR1 | transforming growth factor ... | XM_024447658.1 | 86.2% | 86.2% | 0_1ins207 |
5 | human | 7046 | TGFBR1 | transforming growth factor ... | XM_011518948.2 | 85.6% | 85.6% | 0_1ins207;136_147del |
6 | human | 7046 | TGFBR1 | transforming growth factor ... | XM_017015063.1 | 85.6% | 85.6% | 0_1ins207;136_147del |
7 | human | 7046 | TGFBR1 | transforming growth factor ... | NM_001130916.3 | 84.6% | 84.6% | 342_343ins231 |
8 | human | 7046 | TGFBR1 | transforming growth factor ... | XM_011518950.2 | 70.9% | 70.9% | 0_1ins207;135_136ins231 |
9 | mouse | 21812 | Tgfbr1 | transforming growth factor,... | NM_001312868.1 | 90.4% | 96.4% | (many diffs) |
10 | mouse | 21812 | Tgfbr1 | transforming growth factor,... | NM_009370.3 | 89.7% | 95.6% | (many diffs) |
11 | mouse | 21812 | Tgfbr1 | transforming growth factor,... | XM_017320103.1 | 78.3% | 84.6% | (many diffs) |
12 | mouse | 21812 | Tgfbr1 | transforming growth factor,... | NM_001312869.1 | 75.2% | 73.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1581
- ORF length:
- 1509
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catggaggcg gcggtcgctg ctccgcgtcc ccggctgctc ctcctcgtgc 121 tggcggcggc ggcggcggcg gcggcggcgc tgctcccggg ggcgacggcg ttacagtgtt 181 tctgccacct ctgtacaaaa gacaatttta cttgtgtgac agatgggctc tgctttgtct 241 ctgtcacaga gaccacagac aaagttatac acaacagcat gtgtatagct gaaattgact 301 taattcctcg agataggccg tttgtatgtg caccctcttc aaaaactggg tctgtgacta 361 caacatattg ctgcaatcag gaccattgca ataaaataga acttccaact actgtaaagt 421 catcacctgg ccttggtcct gtggaactgg cagctgtcat tgctggacca gtgtgcttcg 481 tctgcatctc actcatgttg atggtctata tctgccacaa ccgcactgtc attcaccatc 541 gagtgccaaa tgaagaggac ccttcattag atcgcccttt tatttcagag ggtactacgt 601 tgaaagactt aatttatgat atgacaacgt caggttctgg ctcaggttta ccattgcttg 661 ttcagagaac aattgcgaga actattgtgt tacaagaaag cattggcaaa ggtcgatttg 721 gagaagtttg gagaggaaag tggcggggag aagaagttgc tgttaagata ttctcctcta 781 gagaagaacg ttcgtggttc cgtgaggcag agatttatca aactgtaatg ttacgtcatg 841 aaaacatcct gggatttata gcagcagaca ataaagacaa tggtacttgg actcagctct 901 ggttggtgtc agattatcat gagcatggat ccctttttga ttacttaaac agatacacag 961 ttactgtgga aggaatgata aaacttgctc tgtccacggc gagcggtctt gcccatcttc 1021 acatggagat tgttggtacc caaggaaagc cagccattgc tcatagagat ttgaaatcaa 1081 agaatatctt ggtaaagaag aatggaactt gctgtattgc agacttagga ctggcagtaa 1141 gacatgattc agccacagat accattgata ttgctccaaa ccacagagtg ggaacaaaaa 1201 ggtacatggc ccctgaagtt ctcgatgatt ccataaatat gaaacatttt gaaTCCTTCA 1261 AACGTGCTGA CATCTATGCA ATGGGCTTAG TATTCTGGGA AATTGCTCGA CGATGTTCCA 1321 TTGGTGGAAT TCATGAAGAT TACCAACTGC CTTATTATGA TCTTGTACCT TCTGACCCAT 1381 CAGTTGAAGA AATGAGAAAA GTTGTTTGTG AACAGAAGTT AAGGCCAAAT ATCCCAAACA 1441 GATGGCAGAG CTGTGAAGCC TTGAGAGTAA TGGCTAAAAT TATGAGAGAA TGTTGGTATG 1501 CCAATGGAGC AGCTAGGCTT ACAGCATTGC GGATTAAGAA AACATTATCG CAACTCAGTC 1561 AACAGGAAGG CATCAAAATG TAAGACCCAG CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1621 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1681 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA TTCCCATATC 1741 GAACTAAAGT GCAACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1801 att