Transcript: Human XM_024447732.1

PREDICTED: Homo sapiens putative aquaporin-7-like protein 3 (LOC112267859), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC112267859 (112267859)
Length:
2368
CDS:
60..548

Additional Resources:

NCBI RefSeq record:
XM_024447732.1
NBCI Gene record:
LOC112267859 (112267859)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447732.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447732.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13660 pDONR223 100% 52.1% 35.7% None 153_154insC;202_260del;314_486del n/a
2 ccsbBroad304_13660 pLX_304 0% 52.1% 35.7% V5 153_154insC;202_260del;314_486del n/a
3 TRCN0000469925 TGAGAACACATCCGGTCGACACGT pLX_317 100% 52.1% 35.7% V5 153_154insC;202_260del;314_486del n/a
4 ccsbBroadEn_10684 pDONR223 100% 31.2% 23.1% None (many diffs) n/a
5 ccsbBroad304_10684 pLX_304 0% 31.2% 23.1% V5 (many diffs) n/a
6 TRCN0000480437 ATTTCATTATTATATTTCTAGTTA pLX_317 63% 31.2% 23.1% V5 (many diffs) n/a
Download CSV