Transcript: Human XM_024448800.1

PREDICTED: Homo sapiens advillin (AVIL), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AVIL (10677)
Length:
4199
CDS:
1303..3693

Additional Resources:

NCBI RefSeq record:
XM_024448800.1
NBCI Gene record:
AVIL (10677)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448800.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063806 CCTCTACACATACGAGGTAAA pLKO.1 2511 CDS 100% 10.800 15.120 N AVIL n/a
2 TRCN0000432627 TGCCAATATCAGGAAATAATT pLKO_005 3742 3UTR 100% 15.000 10.500 N AVIL n/a
3 TRCN0000429249 CTTCAAAGGGAAGCTAGTTAT pLKO_005 2697 CDS 100% 13.200 9.240 N AVIL n/a
4 TRCN0000425316 GAGCAGATAGTGCCAATATCA pLKO_005 3732 3UTR 100% 5.625 3.938 N AVIL n/a
5 TRCN0000063804 CCTGTGGAGTATCAATGGTAT pLKO.1 2458 CDS 100% 4.950 3.465 N AVIL n/a
6 TRCN0000063805 CGTCTCTTTGAATGTTCCAAT pLKO.1 3082 CDS 100% 4.950 3.465 N AVIL n/a
7 TRCN0000063803 GCAGAAATCAACTATCATGTT pLKO.1 1968 CDS 100% 4.950 3.465 N AVIL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448800.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11537 pDONR223 100% 97.9% 97.9% None 0_1ins48;541A>G n/a
2 ccsbBroad304_11537 pLX_304 0% 97.9% 97.9% V5 0_1ins48;541A>G n/a
3 TRCN0000478506 ACACGAGAGACGTAACAAGATACC pLX_317 13.4% 97.9% 97.9% V5 0_1ins48;541A>G n/a
4 ccsbBroadEn_14524 pDONR223 100% 44.9% 43.6% None (many diffs) n/a
5 ccsbBroad304_14524 pLX_304 0% 44.9% 43.6% V5 (many diffs) n/a
6 TRCN0000465646 TTCTAAGGCGATGGCTCCTTCTAA pLX_317 10.3% 44.9% 43.6% V5 (many diffs) n/a
Download CSV