Transcript: Human XM_024449850.1

PREDICTED: Homo sapiens tau tubulin kinase 2 (TTBK2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTBK2 (146057)
Length:
5388
CDS:
197..3931

Additional Resources:

NCBI RefSeq record:
XM_024449850.1
NBCI Gene record:
TTBK2 (146057)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449850.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257132 GGAGCAAGTAGGCTCTATTAA pLKO_005 892 CDS 100% 15.000 21.000 N TTBK2 n/a
2 TRCN0000230526 AGCGACGCCCACAAGTCTAAT pLKO_005 2143 CDS 100% 13.200 18.480 N TTBK2 n/a
3 TRCN0000230527 GTCCTAGTTGTACTATCAAAT pLKO_005 4561 3UTR 100% 13.200 18.480 N TTBK2 n/a
4 TRCN0000218740 GGAATGATCGATTCAACTATG pLKO_005 450 CDS 100% 10.800 15.120 N TTBK2 n/a
5 TRCN0000230525 TTCGAGGGACAGTTCGTTATG pLKO_005 753 CDS 100% 10.800 15.120 N TTBK2 n/a
6 TRCN0000003230 CTACGCAGATATAAAGTCCTA pLKO.1 3470 CDS 100% 2.640 3.696 N TTBK2 n/a
7 TRCN0000429973 AGCCAGGCTACGCAGATATAA pLKO_005 3463 CDS 100% 15.000 10.500 N Ttbk2 n/a
8 TRCN0000197183 GATGACCTTTGGTCCTTATTC pLKO.1 815 CDS 100% 13.200 9.240 N TTBK2 n/a
9 TRCN0000195181 CTAGACCATATCTCTTCTTTG pLKO.1 971 CDS 100% 10.800 7.560 N TTBK2 n/a
10 TRCN0000194798 CTTTGAAAGGTGTGAGATCTT pLKO.1 3948 3UTR 100% 4.950 3.465 N TTBK2 n/a
11 TRCN0000196283 GCAATGGATTTATAGCTGTTA pLKO.1 1791 CDS 100% 4.950 3.465 N TTBK2 n/a
12 TRCN0000003232 TGCATGTGTGTCCCTGTACTT pLKO.1 3983 3UTR 100% 4.950 3.465 N TTBK2 n/a
13 TRCN0000003233 CCAGATGAACAGCTTAGCGAT pLKO.1 1238 CDS 100% 2.640 1.848 N TTBK2 n/a
14 TRCN0000196284 GTCCCTGTACTTTCTATGTAA pLKO.1 3992 3UTR 100% 5.625 3.375 N TTBK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449850.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488941 CCCTATTACCTGCGAATGTTGACG pLX_317 10.2% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000489416 TCTGCCCAAAACTGACGATTGCGA pLX_317 10% 99.9% 99.9% V5 3732_3733insG n/a
3 TRCN0000489781 CGGGCGTAAACGGCTAGCTTTTAC pLX_317 10.9% 97.1% 97.1% V5 (not translated due to prior stop codon) 433_537del n/a
Download CSV