Transcript: Human XM_024449900.1

PREDICTED: Homo sapiens neuroplastin (NPTN), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NPTN (27020)
Length:
2409
CDS:
287..1360

Additional Resources:

NCBI RefSeq record:
XM_024449900.1
NBCI Gene record:
NPTN (27020)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449900.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312662 GCGAATACCACTGCGTATATC pLKO_005 816 CDS 100% 13.200 18.480 N NPTN n/a
2 TRCN0000331165 GGCGAATACCACTGCGTATAT pLKO_005 815 CDS 100% 13.200 18.480 N NPTN n/a
3 TRCN0000331095 GTGATCTAGCCAGGTACATTT pLKO_005 1513 3UTR 100% 13.200 18.480 N NPTN n/a
4 TRCN0000344928 AGGCGAATACCACTGCGTATA pLKO_005 814 CDS 100% 10.800 15.120 N NPTN n/a
5 TRCN0000061120 GTCGCCCATGTCAGAAACTAA pLKO.1 280 5UTR 100% 5.625 4.500 N NPTN n/a
6 TRCN0000344926 ACCAGTGAAGAGGTCATTATT pLKO_005 629 CDS 100% 15.000 10.500 N NPTN n/a
7 TRCN0000344927 TGTCTAAAGCATGCCTTATTT pLKO_005 1476 3UTR 100% 15.000 10.500 N NPTN n/a
8 TRCN0000247863 CACCAGTGAAGAGGTCATTAT pLKO_005 628 CDS 100% 13.200 9.240 N Nptn n/a
9 TRCN0000296825 CACCAGTGAAGAGGTCATTAT pLKO_005 628 CDS 100% 13.200 9.240 N NPTN n/a
10 TRCN0000061121 CATGGAGTACAGGATCAATAA pLKO.1 775 CDS 100% 13.200 9.240 N NPTN n/a
11 TRCN0000193073 CATGGAGTACAGGATCAATAA pLKO.1 775 CDS 100% 13.200 9.240 N Nptn n/a
12 TRCN0000247865 CATGGAGTACAGGATCAATAA pLKO_005 775 CDS 100% 13.200 9.240 N Nptn n/a
13 TRCN0000291393 CATGGAGTACAGGATCAATAA pLKO_005 775 CDS 100% 13.200 9.240 N NPTN n/a
14 TRCN0000061119 CCTGGCGAGTATGAATGTAAT pLKO.1 1106 CDS 100% 13.200 9.240 N NPTN n/a
15 TRCN0000291319 CCTGGCGAGTATGAATGTAAT pLKO_005 1106 CDS 100% 13.200 9.240 N NPTN n/a
16 TRCN0000061122 CTACCAACAATCACAAAGATA pLKO.1 1311 CDS 100% 5.625 3.938 N NPTN n/a
17 TRCN0000174908 GTATGAATGTAATGCCACCAA pLKO.1 1114 CDS 100% 2.640 1.848 N Nptn n/a
18 TRCN0000061118 GCGTGAGTGTGCTGAGAATAA pLKO.1 465 CDS 100% 13.200 7.920 N NPTN n/a
19 TRCN0000247866 TCATCCTTGTGGTGATCATTG pLKO_005 1227 CDS 100% 10.800 6.480 N Nptn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449900.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02983 pDONR223 100% 74.9% 70.6% None (many diffs) n/a
2 ccsbBroad304_02983 pLX_304 0% 74.9% 70.6% V5 (many diffs) n/a
3 TRCN0000469270 TTACCGGAATGATGAGATGCCCCT pLX_317 48.2% 74.9% 70.6% V5 (many diffs) n/a
Download CSV