Transcript: Human XM_024451248.1

PREDICTED: Homo sapiens low density lipoprotein receptor class A domain containing 4 (LDLRAD4), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LDLRAD4 (753)
Length:
9425
CDS:
1411..2331

Additional Resources:

NCBI RefSeq record:
XM_024451248.1
NBCI Gene record:
LDLRAD4 (753)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451248.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251031 CCTATGTGCAGCACGAGATTG pLKO_005 1889 CDS 100% 10.800 15.120 N Ldlrad4 n/a
2 TRCN0000438041 CCTATGTGCAGCACGAGATTG pLKO_005 1889 CDS 100% 10.800 15.120 N LDLRAD4 n/a
3 TRCN0000148850 CAATGCAGAGAGCACAATAGT pLKO.1 2268 CDS 100% 5.625 7.875 N LDLRAD4 n/a
4 TRCN0000147058 CGAACCATATTTGACAGTGAT pLKO.1 2041 CDS 100% 4.950 6.930 N LDLRAD4 n/a
5 TRCN0000149895 GTTCGCCCAAATCATCATCAT pLKO.1 1602 CDS 100% 4.950 6.930 N LDLRAD4 n/a
6 TRCN0000422839 CACAGAGGTATTTGATGTATT pLKO_005 2633 3UTR 100% 13.200 9.240 N LDLRAD4 n/a
7 TRCN0000422054 GAATAAAGAAGGAAGCATTAT pLKO_005 2715 3UTR 100% 13.200 9.240 N LDLRAD4 n/a
8 TRCN0000149434 GCACAATAGTACCCATCAAAG pLKO.1 2279 CDS 100% 10.800 7.560 N LDLRAD4 n/a
9 TRCN0000148312 CTGCAGTTTCAGCAGAACAAT pLKO.1 2251 CDS 100% 5.625 3.938 N LDLRAD4 n/a
10 TRCN0000149106 GTACCCATCAAAGGCAAAGAT pLKO.1 2287 CDS 100% 0.000 0.000 N LDLRAD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451248.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00195 pDONR223 100% 94.1% 94.1% None 335_388del n/a
2 ccsbBroad304_00195 pLX_304 0% 94.1% 94.1% V5 335_388del n/a
3 TRCN0000475780 TGCGGTATATTATACATCTTCCCA pLX_317 40.4% 94.1% 94.1% V5 335_388del n/a
4 ccsbBroadEn_10703 pDONR223 100% 74% 73.8% None (many diffs) n/a
5 ccsbBroad304_10703 pLX_304 0% 74% 73.8% V5 (many diffs) n/a
6 TRCN0000466878 AAAATCGACTATGATTGACAGGTG pLX_317 58.9% 74% 73.8% V5 (many diffs) n/a
Download CSV