Transcript: Human XM_024451875.1

PREDICTED: Homo sapiens GNAS complex locus (GNAS), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GNAS (2778)
Length:
1556
CDS:
186..1193

Additional Resources:

NCBI RefSeq record:
XM_024451875.1
NBCI Gene record:
GNAS (2778)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451875.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310794 ACCCACCATAGGGCATGATTA pLKO_005 1272 3UTR 100% 13.200 18.480 N GNAS n/a
2 TRCN0000303965 TCACTACTGCTACCCTCATTT pLKO_005 1076 CDS 100% 13.200 18.480 N GNAS n/a
3 TRCN0000083416 CAGAATTTGCTCGCTACACTA pLKO.1 946 CDS 100% 4.950 6.930 N GNAS n/a
4 TRCN0000300317 CAGAATTTGCTCGCTACACTA pLKO_005 946 CDS 100% 4.950 6.930 N GNAS n/a
5 TRCN0000369979 TAAAGCCTTAAGCACAATTAA pLKO_005 1216 3UTR 100% 15.000 10.500 N GNAS n/a
6 TRCN0000115056 CCTGCATGTTAATGGGTTTAA pLKO.1 194 CDS 100% 13.200 9.240 N Gnas n/a
7 TRCN0000320192 CCTGCATGTTAATGGGTTTAA pLKO_005 194 CDS 100% 13.200 9.240 N Gnas n/a
8 TRCN0000083413 GCTTGCTTAGATGTTCCAAAT pLKO.1 1349 3UTR 100% 10.800 7.560 N GNAS n/a
9 TRCN0000083417 CAACGATGTGACTGCCATCAT pLKO.1 722 CDS 100% 4.950 3.465 N GNAS n/a
10 TRCN0000331232 CAACGATGTGACTGCCATCAT pLKO_005 722 CDS 100% 4.950 3.465 N GNAS n/a
11 TRCN0000083414 GCCAAGTACTTCATTCGAGAT pLKO.1 1017 CDS 100% 4.050 2.835 N GNAS n/a
12 TRCN0000300316 GCCAAGTACTTCATTCGAGAT pLKO_005 1017 CDS 100% 4.050 2.835 N GNAS n/a
13 TRCN0000083415 CCTCCCGAATTCTATGAGCAT pLKO.1 435 CDS 100% 0.000 0.000 N GNAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451875.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15431 pDONR223 0% 84.9% 85% None 0_1ins177;216C>T n/a
2 ccsbBroad304_15431 pLX_304 0% 84.9% 85% V5 0_1ins177;216C>T n/a
3 TRCN0000473616 GACTTATCGCTAGTTCTTCAGTAC pLX_317 47.5% 84.8% 85% V5 0_1ins177;216C>T;1005C>T n/a
4 ccsbBroadEn_00652 pDONR223 100% 84.8% 84.8% None 0_1ins177;79_80insGCA n/a
5 ccsbBroad304_00652 pLX_304 0% 84.8% 84.8% V5 0_1ins177;79_80insGCA n/a
6 TRCN0000478852 GCCGCACGACTCTCAATGTTCATT pLX_317 29.2% 84.8% 84.8% V5 0_1ins177;79_80insGCA n/a
Download CSV