Transcript: Human XM_024452516.1

PREDICTED: Homo sapiens pyridoxal-dependent decarboxylase domain-containing protein 1 (LOC102724985), transcript variant X15, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC102724985 (102724985)
Length:
2085
CDS:
16..1635

Additional Resources:

NCBI RefSeq record:
XM_024452516.1
NBCI Gene record:
LOC102724985 (102724985)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452516.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000133781 CCTTATGGCTATGCAGAATTT pLKO.1 521 CDS 100% 13.200 6.600 Y PDXDC2P-NPIPB14P n/a
2 TRCN0000163994 CCACGTTAGCTGAAATGGGAA pLKO.1 188 CDS 100% 2.640 1.320 Y PDXDC1 n/a
3 TRCN0000135390 GCTTATTTCCACGAAGAGGAA pLKO.1 562 CDS 100% 2.640 1.320 Y PDXDC2P-NPIPB14P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452516.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11663 pDONR223 100% 83.2% 79.6% None (many diffs) n/a
2 ccsbBroad304_11663 pLX_304 0% 83.2% 79.6% V5 (many diffs) n/a
3 TRCN0000475295 AGTCTTGCGTGTCTGTGAATAAAT pLX_317 24% 83.2% 79.6% V5 (many diffs) n/a
4 ccsbBroadEn_10342 pDONR223 100% 75% 73.8% None (many diffs) n/a
5 ccsbBroad304_10342 pLX_304 0% 75% 73.8% V5 (many diffs) n/a
6 TRCN0000479086 GTGACACGCCACTTGGAGCACCGT pLX_317 32% 75% 73.8% V5 (many diffs) n/a
Download CSV