Transcript: Human XM_024452755.1

PREDICTED: Homo sapiens EGF containing fibulin extracellular matrix protein 1 (EFEMP1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EFEMP1 (2202)
Length:
3047
CDS:
463..1944

Additional Resources:

NCBI RefSeq record:
XM_024452755.1
NBCI Gene record:
EFEMP1 (2202)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452755.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055966 GCGTAGACATAGATGAATGTA pLKO.1 1097 CDS 100% 5.625 7.313 N EFEMP1 n/a
2 TRCN0000291534 GCGTAGACATAGATGAATGTA pLKO_005 1097 CDS 100% 5.625 7.313 N EFEMP1 n/a
3 TRCN0000055965 CCAGTCAATAGTCTACAAATA pLKO.1 1632 CDS 100% 13.200 9.240 N EFEMP1 n/a
4 TRCN0000307721 CCAGTCAATAGTCTACAAATA pLKO_005 1632 CDS 100% 13.200 9.240 N EFEMP1 n/a
5 TRCN0000055964 GCCACCAAAGATGCGTGAATA pLKO.1 1133 CDS 100% 13.200 9.240 N EFEMP1 n/a
6 TRCN0000055967 CCTGTGAGACAGCAATGCAAA pLKO.1 571 CDS 100% 4.950 3.465 N EFEMP1 n/a
7 TRCN0000291535 CCTGTGAGACAGCAATGCAAA pLKO_005 571 CDS 100% 4.950 3.465 N EFEMP1 n/a
8 TRCN0000109681 GCTCTGTGTTAAGATTGACAA pLKO.1 1898 CDS 100% 4.950 3.465 N Efemp1 n/a
9 TRCN0000351791 GCTCTGTGTTAAGATTGACAA pLKO_005 1898 CDS 100% 4.950 3.465 N Efemp1 n/a
10 TRCN0000055963 GCCCAGATTATTGTCAATAAT pLKO.1 685 CDS 100% 1.500 1.050 N EFEMP1 n/a
11 TRCN0000291533 GCCCAGATTATTGTCAATAAT pLKO_005 685 CDS 100% 1.500 1.050 N EFEMP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452755.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00541 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00541 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473809 TCTCGTGATTGAAAGAGCAGATGC pLX_317 21.3% 100% 100% V5 n/a
Download CSV