Transcript: Human XM_024453134.1

PREDICTED: Homo sapiens transient receptor potential cation channel subfamily M member 8 (TRPM8), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRPM8 (79054)
Length:
4624
CDS:
229..2358

Additional Resources:

NCBI RefSeq record:
XM_024453134.1
NBCI Gene record:
TRPM8 (79054)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453134.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413080 TCATACTTGAAGACGGATATA pLKO_005 2538 3UTR 100% 13.200 18.480 N TRPM8 n/a
2 TRCN0000045072 CGGCTCCACTCTTCTAATAAA pLKO.1 1489 CDS 100% 15.000 12.000 N TRPM8 n/a
3 TRCN0000045069 GCTGTGGCTTTGTATCATTTA pLKO.1 1160 CDS 100% 13.200 9.240 N TRPM8 n/a
4 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 3723 3UTR 100% 4.050 2.025 Y P3H4 n/a
5 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 3723 3UTR 100% 4.050 2.025 Y ORAI2 n/a
6 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 3723 3UTR 100% 4.050 2.025 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453134.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12538 pDONR223 100% 75.6% 75.6% None 0_1ins249;838_1167del n/a
2 ccsbBroad304_12538 pLX_304 0% 75.6% 75.6% V5 0_1ins249;838_1167del n/a
3 TRCN0000470687 TTAGGGATGGAAAGTCCTTAGTTC pLX_317 15.5% 75.6% 75.6% V5 0_1ins249;838_1167del n/a
Download CSV