Transcript: Human XM_024453562.1

PREDICTED: Homo sapiens arginine and serine rich coiled-coil 1 (RSRC1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RSRC1 (51319)
Length:
6491
CDS:
169..702

Additional Resources:

NCBI RefSeq record:
XM_024453562.1
NBCI Gene record:
RSRC1 (51319)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453562.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130228 CGAGGGAAATCCTATAGAGTT pLKO.1 436 CDS 100% 4.950 3.960 N RSRC1 n/a
2 TRCN0000281074 CGAGGGAAATCCTATAGAGTT pLKO_005 436 CDS 100% 4.950 3.960 N RSRC1 n/a
3 TRCN0000128605 CCTCGTTCACATTCTTATGAT pLKO.1 337 CDS 100% 5.625 3.938 N RSRC1 n/a
4 TRCN0000281075 CCTCGTTCACATTCTTATGAT pLKO_005 337 CDS 100% 5.625 3.938 N RSRC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453562.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15837 pDONR223 0% 62.2% 56.3% None (many diffs) n/a
2 ccsbBroad304_15837 pLX_304 0% 62.2% 56.3% V5 (many diffs) n/a
3 TRCN0000473767 CCCCACCGGGTTAAATCTTCCTCC pLX_317 10.8% 62.2% 56.3% V5 (many diffs) n/a
4 ccsbBroadEn_03283 pDONR223 100% 51.4% 46.7% None (many diffs) n/a
5 ccsbBroad304_03283 pLX_304 0% 51.4% 46.7% V5 (many diffs) n/a
6 TRCN0000465673 AAAGGGTATCAGTCACCATAACAA pLX_317 29.2% 51.4% 46.7% V5 (many diffs) n/a
Download CSV