Transcript: Human XM_024454014.1

PREDICTED: Homo sapiens EYA transcriptional coactivator and phosphatase 3 (EYA3), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EYA3 (2140)
Length:
2023
CDS:
256..1707

Additional Resources:

NCBI RefSeq record:
XM_024454014.1
NBCI Gene record:
EYA3 (2140)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024454014.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051603 CCCTTCTACAAGTCCATCTTT pLKO.1 732 CDS 100% 5.625 4.500 N EYA3 n/a
2 TRCN0000029858 CCCTCGCTCATCCAATGATTA pLKO.1 276 CDS 100% 13.200 9.240 N Eya3 n/a
3 TRCN0000231182 CCCTCGCTCATCCAATGATTA pLKO_005 276 CDS 100% 13.200 9.240 N Eya3 n/a
4 TRCN0000051607 CCTGGTTAGGAACTGCATTAA pLKO.1 1331 CDS 100% 13.200 9.240 N EYA3 n/a
5 TRCN0000231183 GATTATCCCACCTATACTATT pLKO_005 544 CDS 100% 13.200 9.240 N Eya3 n/a
6 TRCN0000051605 CCGGAAAGTGAGAGAAATCTA pLKO.1 1215 CDS 100% 5.625 3.938 N EYA3 n/a
7 TRCN0000029855 CCAATGATTATACCTCACAAA pLKO.1 287 CDS 100% 4.950 3.465 N Eya3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024454014.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10815 pDONR223 100% 90.1% 90.1% None 0_1ins159 n/a
2 ccsbBroad304_10815 pLX_304 0% 90.1% 90.1% V5 0_1ins159 n/a
3 TRCN0000467722 GACCTGGTTTTCTGTAAATTCGCG pLX_317 23.4% 90.1% 90.1% V5 0_1ins159 n/a
4 TRCN0000489799 TACGGGGGAAATTGGTGCTGCGTT pLX_317 22.1% 90.1% 90.1% V5 (not translated due to prior stop codon) 0_1ins159 n/a
5 TRCN0000491915 CCGTCATCTACTAAGTACAGCCCC pLX_317 23.9% 89.9% 90.1% V5 0_1ins159;1448_1449delTA n/a
Download CSV