Transcript: Human XM_024454173.1

PREDICTED: Homo sapiens Rap1 GTPase-GDP dissociation stimulator 1 (RAP1GDS1), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAP1GDS1 (5910)
Length:
3657
CDS:
483..1916

Additional Resources:

NCBI RefSeq record:
XM_024454173.1
NBCI Gene record:
RAP1GDS1 (5910)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024454173.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029790 CCCTTATACGACACAGTAAAT pLKO.1 1507 CDS 100% 13.200 18.480 N RAP1GDS1 n/a
2 TRCN0000344256 CCCTTATACGACACAGTAAAT pLKO_005 1507 CDS 100% 13.200 18.480 N RAP1GDS1 n/a
3 TRCN0000029793 GCTGAACAATTGGGAAAGAAT pLKO.1 1401 CDS 100% 5.625 3.938 N RAP1GDS1 n/a
4 TRCN0000344337 GCTGAACAATTGGGAAAGAAT pLKO_005 1401 CDS 100% 5.625 3.938 N RAP1GDS1 n/a
5 TRCN0000029792 GCTAACATCATAGCAGAAGTA pLKO.1 389 5UTR 100% 4.950 3.465 N RAP1GDS1 n/a
6 TRCN0000344253 GCTAACATCATAGCAGAAGTA pLKO_005 389 5UTR 100% 4.950 3.465 N RAP1GDS1 n/a
7 TRCN0000029789 GCCAGTACAAACATTGCTGAA pLKO.1 753 CDS 100% 4.050 2.835 N RAP1GDS1 n/a
8 TRCN0000344336 GCCAGTACAAACATTGCTGAA pLKO_005 753 CDS 100% 4.050 2.835 N RAP1GDS1 n/a
9 TRCN0000029791 GCAGAACTTGAGTCAAGTAAA pLKO.1 723 CDS 100% 13.200 7.920 N RAP1GDS1 n/a
10 TRCN0000344335 GCAGAACTTGAGTCAAGTAAA pLKO_005 723 CDS 100% 13.200 7.920 N RAP1GDS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024454173.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15560 pDONR223 0% 78.5% 78.5% None 0_1ins243;121_122ins147 n/a
2 ccsbBroad304_15560 pLX_304 0% 78.5% 78.5% V5 0_1ins243;121_122ins147 n/a
3 TRCN0000473828 ACCTTAGATAAAGTTGCTTTGGAC pLX_317 31.2% 78.5% 78.5% V5 0_1ins243;121_122ins147 n/a
4 ccsbBroadEn_06840 pDONR223 100% 78.3% 78.2% None (many diffs) n/a
5 ccsbBroad304_06840 pLX_304 0% 78.3% 78.2% V5 (many diffs) n/a
6 TRCN0000472959 AGAGCGGCCACCCTCAACTTCTCT pLX_317 5.6% 78.3% 78.2% V5 (many diffs) n/a
Download CSV