Transcript: Human XR_001738710.1

PREDICTED: Homo sapiens EMAP like 4 (EML4), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EML4 (27436)
Length:
5597
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001738710.1
NBCI Gene record:
EML4 (27436)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001738710.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303638 TCAGATGATAGCCGTAATAAA pLKO_005 763 3UTR 100% 15.000 21.000 N EML4 n/a
2 TRCN0000117340 CGGCAATTCACTAACAAGAAA pLKO.1 1518 3UTR 100% 5.625 7.875 N EML4 n/a
3 TRCN0000117339 CGGCCAATTACCATGTTCATT pLKO.1 901 3UTR 100% 5.625 7.875 N EML4 n/a
4 TRCN0000117338 GCGGCAATTCACTAACAAGAA pLKO.1 1517 3UTR 100% 4.950 6.930 N EML4 n/a
5 TRCN0000299398 GCGGCAATTCACTAACAAGAA pLKO_005 1517 3UTR 100% 4.950 6.930 N EML4 n/a
6 TRCN0000117337 CGCCAGTAAGTATCAGGCATA pLKO.1 5079 3UTR 100% 4.050 3.240 N EML4 n/a
7 TRCN0000299477 CGCCAGTAAGTATCAGGCATA pLKO_005 5079 3UTR 100% 4.050 3.240 N EML4 n/a
8 TRCN0000303639 CATCAGTAGTAGTACTATTTA pLKO_005 1067 3UTR 100% 15.000 10.500 N EML4 n/a
9 TRCN0000117341 CGGATTGTAAGGACATTGATT pLKO.1 2592 3UTR 100% 5.625 3.938 N EML4 n/a
10 TRCN0000299397 CGGATTGTAAGGACATTGATT pLKO_005 2592 3UTR 100% 5.625 3.938 N EML4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001738710.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15797 pDONR223 0% 3.3% None 1_5142del;5329_5597del n/a
2 ccsbBroad304_15797 pLX_304 0% 3.3% V5 1_5142del;5329_5597del n/a
3 TRCN0000472781 ATGCAAACTCCAACCCTCAAAGTC pLX_317 100% 3.2% V5 (many diffs) n/a
4 TRCN0000478304 GTACTCAGGTGTCGGGTGAAGGCC pLX_317 100% 3.2% V5 (many diffs) n/a
Download CSV