Transcript: Human XR_001740056.2

PREDICTED: Homo sapiens 3-hydroxyacyl-CoA dehydratase 2 (HACD2), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HACD2 (201562)
Length:
949
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001740056.2
NBCI Gene record:
HACD2 (201562)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001740056.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161939 GATCACGGAAATCATCCGTTA pLKO.1 478 3UTR 100% 0.405 0.567 N HACD2 n/a
2 TRCN0000166515 CGGAAATCATCCGTTACTCCT pLKO.1 483 3UTR 100% 2.640 2.112 N HACD2 n/a
3 TRCN0000370970 AGGAGAACTGCTCACAATATA pLKO_005 595 3UTR 100% 15.000 10.500 N HACD2 n/a
4 TRCN0000030088 GCTACCATAGCCTTTATTATT pLKO.1 258 3UTR 100% 15.000 10.500 N Hacd2 n/a
5 TRCN0000365688 CAGACAAGCTGGCCTATATTC pLKO_005 634 3UTR 100% 13.200 9.240 N HACD2 n/a
6 TRCN0000365689 CTATGCATTCCTGATTCTAAT pLKO_005 694 3UTR 100% 13.200 9.240 N HACD2 n/a
7 TRCN0000376663 GCATGGACGATCACGGAAATC pLKO_005 470 3UTR 100% 10.800 7.560 N HACD2 n/a
8 TRCN0000030086 GCGTACCTGGTCATCTACAAT pLKO.1 170 3UTR 100% 5.625 3.938 N Hacd2 n/a
9 TRCN0000160315 CCAGTTATACTTCCACATGAT pLKO.1 883 3UTR 100% 4.950 3.465 N HACD2 n/a
10 TRCN0000160585 CTATAGGAATTGTTCCATCTT pLKO.1 339 3UTR 100% 4.950 3.465 N HACD2 n/a
11 TRCN0000030085 CCTGACTTCTTTCCAGGTGAT pLKO.1 367 3UTR 100% 4.050 2.835 N Hacd2 n/a
12 TRCN0000159607 GTCTATTAAACCATCTGCCTT pLKO.1 516 3UTR 100% 2.640 1.848 N HACD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001740056.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05198 pDONR223 100% 79.1% None 1_52del;735_875del;949_950insTTTGAA n/a
2 ccsbBroad304_05198 pLX_304 0% 79.1% V5 1_52del;735_875del;949_950insTTTGAA n/a
3 TRCN0000466043 TCTCGACATAGAGGAGGGGCTGAC pLX_317 47.3% 79.1% V5 1_52del;735_875del;949_950insTTTGAA n/a
Download CSV