Transcript: Human XR_001741353.2

PREDICTED: Homo sapiens TBC1 domain containing kinase (TBCK), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TBCK (93627)
Length:
2662
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001741353.2
NBCI Gene record:
TBCK (93627)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001741353.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196356 GCTAAAGGCTTATCCATATAA pLKO.1 1684 3UTR 100% 15.000 21.000 N TBCK n/a
2 TRCN0000226445 GCTAAAGGCTTATCCATATAA pLKO_005 1684 3UTR 100% 15.000 21.000 N TBCK n/a
3 TRCN0000226446 AGAAGTTCGGCACCTTATTTC pLKO_005 2519 3UTR 100% 13.200 18.480 N TBCK n/a
4 TRCN0000218128 CAAGTACGATGCAATTGATAA pLKO_005 1804 3UTR 100% 13.200 18.480 N TBCK n/a
5 TRCN0000377214 GGGCGCTTTCAAATCCTTAAA pLKO_005 458 3UTR 100% 13.200 18.480 N TBCK n/a
6 TRCN0000367607 CTGCCAGTATGTGGATATTTC pLKO_005 499 3UTR 100% 13.200 10.560 N TBCK n/a
7 TRCN0000197039 GCTGAACATTGTGAACGTAGT pLKO.1 551 3UTR 100% 4.050 3.240 N TBCK n/a
8 TRCN0000194758 CCTCATTCAAACAGCAATAAT pLKO.1 1574 3UTR 100% 15.000 10.500 N TBCK n/a
9 TRCN0000367448 GACAAATTGAAGTGGATATTC pLKO_005 1848 3UTR 100% 13.200 9.240 N TBCK n/a
10 TRCN0000007078 GCATGGTTGTTTGGACATTAT pLKO.1 1036 3UTR 100% 13.200 9.240 N TBCK n/a
11 TRCN0000226444 GGATACAGAGTACCAACTAAA pLKO_005 1639 3UTR 100% 13.200 9.240 N TBCK n/a
12 TRCN0000194737 CCAGTCTAATTTACCTCATTC pLKO.1 1561 3UTR 100% 10.800 7.560 N TBCK n/a
13 TRCN0000197111 GCAAGGTCTTGACTCACTTTG pLKO.1 1975 3UTR 100% 10.800 7.560 N TBCK n/a
14 TRCN0000007079 CCAGCTAAGAAATAGATTGAA pLKO.1 1498 3UTR 100% 5.625 3.938 N TBCK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001741353.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04607 pDONR223 100% 72.4% None (many diffs) n/a
2 ccsbBroad304_04607 pLX_304 0% 72.4% V5 (many diffs) n/a
3 TRCN0000465987 CAAGAGCCGTGAGACGTTCAGATC pLX_317 15.4% 72.4% V5 (many diffs) n/a
4 ccsbBroadEn_04606 pDONR223 100% 70% None (many diffs) n/a
5 ccsbBroad304_04606 pLX_304 0% 70% V5 (many diffs) n/a
6 TRCN0000480238 GGGTTTGGCTTAGTACCATGTGCC pLX_317 17.7% 70% V5 (many diffs) n/a
7 ccsbBroadEn_15218 pDONR223 0% 70% None (many diffs) n/a
8 ccsbBroad304_15218 pLX_304 0% 70% V5 (many diffs) n/a
Download CSV