Transcript: Human XR_001742148.1

PREDICTED: Homo sapiens centrosomal protein 72 (CEP72), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CEP72 (55722)
Length:
2138
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001742148.1
NBCI Gene record:
CEP72 (55722)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001742148.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235040 GACACTGCAGCCACGTTAAAT pLKO_005 1575 3UTR 100% 15.000 21.000 N CEP72 n/a
2 TRCN0000134416 GAGCTTCAGTCATTGTCTATT pLKO.1 27 3UTR 100% 13.200 18.480 N CEP72 n/a
3 TRCN0000235037 GAGCTTCAGTCATTGTCTATT pLKO_005 27 3UTR 100% 13.200 18.480 N CEP72 n/a
4 TRCN0000133908 CTGGATGATTTGAGACAACAT pLKO.1 1479 3UTR 100% 4.950 6.930 N CEP72 n/a
5 TRCN0000133875 CATTGTCTATTCCTGGAACTT pLKO.1 37 3UTR 100% 4.950 3.960 N CEP72 n/a
6 TRCN0000235039 GGAAGAGAACAGTAGGTTAAA pLKO_005 1514 3UTR 100% 13.200 9.240 N CEP72 n/a
7 TRCN0000235038 TGTTTCGGCTCCACGCCTTAA pLKO_005 223 3UTR 100% 10.800 7.560 N CEP72 n/a
8 TRCN0000138409 CGCTGGACTTCAAACAAGTGT pLKO.1 1604 3UTR 100% 3.000 2.100 N CEP72 n/a
9 TRCN0000137706 GCCTCTTCTCAGAAGTTGGAT pLKO.1 870 3UTR 100% 3.000 2.100 N CEP72 n/a
10 TRCN0000134023 CAATCTCTACTACAACTGCAT pLKO.1 185 3UTR 100% 2.640 1.848 N CEP72 n/a
11 TRCN0000137979 GCATTCAGTACCTGACTGCAT pLKO.1 154 3UTR 100% 2.640 1.848 N CEP72 n/a
12 TRCN0000138919 GCTTCTTTGAAAGAGGGCAGA pLKO.1 435 3UTR 100% 2.160 1.512 N CEP72 n/a
13 TRCN0000135267 CCAAGAATCCAGACATCTGTT pLKO.1 629 3UTR 100% 4.950 2.970 N CEP72 n/a
14 TRCN0000136193 GTTGGAAGATTCCAGACGTTT pLKO.1 957 3UTR 100% 4.950 2.970 N CEP72 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001742148.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03640 pDONR223 100% 85.3% None (many diffs) n/a
2 ccsbBroad304_03640 pLX_304 0% 85.3% V5 (many diffs) n/a
3 TRCN0000466154 AGAGTTTACACGCATGCCCGAGAG pLX_317 20.7% 85.3% V5 (many diffs) n/a
4 ccsbBroadEn_15911 pDONR223 0% 64.2% None 1_509del;1884_2138del n/a
5 ccsbBroad304_15911 pLX_304 0% 64.2% V5 1_509del;1884_2138del n/a
6 TRCN0000478608 CTGGTCCCGATACCGCACTCTGTA pLX_317 25.7% 64.2% V5 1_509del;1884_2138del n/a
Download CSV