Transcript: Human XR_001744643.2

PREDICTED: Homo sapiens piccolo presynaptic cytomatrix protein (PCLO), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PCLO (27445)
Length:
22942
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001744643.2
NBCI Gene record:
PCLO (27445)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001744643.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000448162 ACCGAGGGCTATACGACTAAA pLKO_005 12667 3UTR 100% 13.200 18.480 N PCLO n/a
2 TRCN0000056484 CCACGAAATTATGTCCTAATT pLKO.1 13696 3UTR 100% 1.320 1.848 N PCLO n/a
3 TRCN0000056486 CCCTTATGATAGCACCTGTTT pLKO.1 13523 3UTR 100% 4.950 3.960 N PCLO n/a
4 TRCN0000441676 GGATGCTAATAGAGGATTATA pLKO_005 7415 3UTR 100% 15.000 10.500 N PCLO n/a
5 TRCN0000056485 CCTCTGTCTATGGGCTTGATT pLKO.1 14456 3UTR 100% 5.625 3.938 N PCLO n/a
6 TRCN0000056483 GCCCTATTAAAGGAGAGAGAA pLKO.1 13000 3UTR 100% 4.950 3.465 N PCLO n/a
7 TRCN0000056487 CCCAGAATTCTGAAGAAGAAA pLKO.1 14633 3UTR 100% 0.000 0.000 N PCLO n/a
8 TRCN0000200399 GTGGTTCAGAAGGAGCAAGAA pLKO.1 2152 3UTR 100% 4.950 3.465 N Eif4h n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001744643.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11867 pDONR223 100% .5% None 1_15225del;15324_15331delTGTAAGAC;15357_22942del n/a
2 ccsbBroad304_11867 pLX_304 0% .5% V5 1_15225del;15324_15331delTGTAAGAC;15357_22942del n/a
3 TRCN0000466005 CAACCGCAGTAGCTAGCACTAACG pLX_317 100% .5% V5 1_15225del;15324_15331delTGTAAGAC;15357_22942del n/a
Download CSV