Transcript: Human XR_001744802.1

PREDICTED: Homo sapiens phosphodiesterase 1C (PDE1C), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PDE1C (5137)
Length:
2924
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001744802.1
NBCI Gene record:
PDE1C (5137)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001744802.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435839 TCGAACCTTGGTAATTGAAAT pLKO_005 1287 3UTR 100% 13.200 18.480 N PDE1C n/a
2 TRCN0000429736 ACTCGGTCTGATCCAGCTATT pLKO_005 1147 3UTR 100% 10.800 15.120 N PDE1C n/a
3 TRCN0000048761 CCAGCTGTTATTGAGGCATTA pLKO.1 769 3UTR 100% 10.800 15.120 N PDE1C n/a
4 TRCN0000048760 GCGTTCGAGTTTGAATAGCAT pLKO.1 1698 3UTR 100% 3.000 4.200 N PDE1C n/a
5 TRCN0000114925 CCGAGAAGATTGTGAGTCCAT pLKO.1 1637 3UTR 100% 2.640 3.696 N Pde1c n/a
6 TRCN0000048759 CGGTCTTTGGTCAAACAATTA pLKO.1 433 3UTR 100% 13.200 10.560 N PDE1C n/a
7 TRCN0000433484 GAAGATTGTGAGTCCATTAAT pLKO_005 1641 3UTR 100% 15.000 10.500 N PDE1C n/a
8 TRCN0000420303 GGGATCATGCACTGAAATTTA pLKO_005 842 3UTR 100% 15.000 10.500 N PDE1C n/a
9 TRCN0000048762 CCGTTGACTATAAGAGCTTTA pLKO.1 1799 3UTR 100% 10.800 7.560 N PDE1C n/a
10 TRCN0000417441 GCTTCAGTGGTAGATCTTAAG pLKO_005 466 3UTR 100% 10.800 7.560 N PDE1C n/a
11 TRCN0000437003 TGACGGAGCTGGAGATCTTTG pLKO_005 1058 3UTR 100% 10.800 7.560 N PDE1C n/a
12 TRCN0000048758 CCCGATCAACAATTCTGTCAT pLKO.1 1776 3UTR 100% 4.950 3.465 N PDE1C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001744802.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06700 pDONR223 100% 63.5% None (many diffs) n/a
2 ccsbBroad304_06700 pLX_304 0% 63.5% V5 (many diffs) n/a
3 TRCN0000474141 CATGACTATCGAGCGACTGTGACG pLX_317 23.8% 63.5% V5 (many diffs) n/a
4 TRCN0000489302 TGCATTTGGATGGTAACTCATCGC pLX_317 20.1% 63.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV