Transcript: Human XR_001744845.2

PREDICTED: Homo sapiens exocyst complex component 4 (EXOC4), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EXOC4 (60412)
Length:
4042
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001744845.2
NBCI Gene record:
EXOC4 (60412)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001744845.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160384 CAAGAAGATAACTACCGTTTA pLKO.1 2931 3UTR 100% 10.800 15.120 N EXOC4 n/a
2 TRCN0000160077 CCTGAACTTGTTGGATGAAAT pLKO.1 399 3UTR 100% 13.200 9.240 N EXOC4 n/a
3 TRCN0000160821 CCCAGAAACAGTTAAGGCAAT pLKO.1 903 3UTR 100% 4.050 2.835 N EXOC4 n/a
4 TRCN0000164165 CCTCATTAATGGTGCCCAGTA pLKO.1 2580 3UTR 100% 4.050 2.835 N EXOC4 n/a
5 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 3795 3UTR 100% 4.950 2.475 Y CFLAR n/a
6 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 3795 3UTR 100% 4.950 2.475 Y C19orf31 n/a
7 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 3793 3UTR 100% 4.950 2.475 Y ERN2 n/a
8 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 3793 3UTR 100% 4.950 2.475 Y P3H4 n/a
9 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 3793 3UTR 100% 4.950 2.475 Y P3H4 n/a
10 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 3959 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001744845.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08793 pDONR223 100% 35.1% None 1_27del;1446_1451delGGGTCC;1455_4042delinsG n/a
2 ccsbBroad304_08793 pLX_304 0% 35.1% V5 1_27del;1446_1451delGGGTCC;1455_4042delinsG n/a
3 TRCN0000471162 TATGGGGGAAAAATCAGCCTTACT pLX_317 35.5% 35.1% V5 1_27del;1446_1451delGGGTCC;1455_4042delinsG n/a
Download CSV