Transcript: Human XR_001744863.2

PREDICTED: Homo sapiens SRSF protein kinase 2 (SRPK2), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SRPK2 (6733)
Length:
4151
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001744863.2
NBCI Gene record:
SRPK2 (6733)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001744863.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006277 CGTTGTGTGAAGAGTATCATT pLKO.1 735 3UTR 100% 5.625 7.875 N SRPK2 n/a
2 TRCN0000277860 CGTTGTGTGAAGAGTATCATT pLKO_005 735 3UTR 100% 5.625 7.875 N SRPK2 n/a
3 TRCN0000006275 GCCGGTATCATGTTATTAGAA pLKO.1 409 3UTR 100% 5.625 4.500 N SRPK2 n/a
4 TRCN0000277858 GCCGGTATCATGTTATTAGAA pLKO_005 409 3UTR 100% 5.625 4.500 N SRPK2 n/a
5 TRCN0000006276 CCTGAGGAATATAATCTTGAT pLKO.1 1404 3UTR 100% 4.950 3.960 N SRPK2 n/a
6 TRCN0000277855 CCTGAGGAATATAATCTTGAT pLKO_005 1404 3UTR 100% 4.950 3.960 N SRPK2 n/a
7 TRCN0000197040 GAGACAGCCTTGGATGAAATA pLKO.1 531 3UTR 100% 13.200 9.240 N SRPK2 n/a
8 TRCN0000006278 GCAACGGGAGATTATTTGTTT pLKO.1 1905 3UTR 100% 5.625 3.938 N SRPK2 n/a
9 TRCN0000297051 GCAACGGGAGATTATTTGTTT pLKO_005 1905 3UTR 100% 5.625 3.938 N SRPK2 n/a
10 TRCN0000006274 GCACCCTGTAAATGTTACTTT pLKO.1 2526 3UTR 100% 5.625 3.938 N SRPK2 n/a
11 TRCN0000277859 GCACCCTGTAAATGTTACTTT pLKO_005 2526 3UTR 100% 5.625 3.938 N SRPK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001744863.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01594 pDONR223 100% 49.7% None 1_173del;2238_4151del n/a
2 ccsbBroad304_01594 pLX_304 0% 49.7% V5 1_173del;2238_4151del n/a
3 ccsbBroadEn_14847 pDONR223 0% 49.7% None 1_173del;2238_4151del n/a
4 ccsbBroad304_14847 pLX_304 0% 49.7% V5 1_173del;2238_4151del n/a
5 TRCN0000466082 GGAGGCGATTGTTTTCGAACATGA pLX_317 15.5% 49.6% V5 1_173del;2229T>A;2238_4151del n/a
6 TRCN0000489410 TGGGACTGCATACCAAAGATACGG pLX_317 16.7% 49.6% V5 1_173del;1290A>G;2238_4151delinsG n/a
7 TRCN0000489739 AGAACCGGCTTCTTCCAGTACGTG pLX_317 21.4% 49.6% V5 (not translated due to prior stop codon) 1_173del;1290A>G;2238_4151del n/a
8 ccsbBroadEn_06999 pDONR223 100% 49.6% None (many diffs) n/a
9 ccsbBroad304_06999 pLX_304 0% 49.6% V5 (many diffs) n/a
10 TRCN0000473240 CAAGGCTGTACCTCATATTCCTAA pLX_317 19% 49.6% V5 (many diffs) n/a
Download CSV