Transcript: Human XR_001747004.2

PREDICTED: Homo sapiens pitrilysin metallopeptidase 1 (PITRM1), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PITRM1 (10531)
Length:
3561
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001747004.2
NBCI Gene record:
PITRM1 (10531)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001747004.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310116 CCGGACATCACCGACACATTT pLKO_005 1043 3UTR 100% 13.200 18.480 N PITRM1 n/a
2 TRCN0000052241 CGGTGAATTACGTGGGTGAAT pLKO.1 2729 3UTR 100% 4.950 6.930 N PITRM1 n/a
3 TRCN0000052240 CCAGCGTTGAAAGTTTCCGAT pLKO.1 1712 3UTR 100% 2.640 3.696 N PITRM1 n/a
4 TRCN0000296025 TACACCTCCGAGCTGAATATG pLKO_005 3297 3UTR 100% 13.200 9.240 N PITRM1 n/a
5 TRCN0000052242 CCCAAGCAATGCTAGGTTCTT pLKO.1 817 3UTR 100% 4.950 3.465 N PITRM1 n/a
6 TRCN0000288803 CCCAAGCAATGCTAGGTTCTT pLKO_005 817 3UTR 100% 4.950 3.465 N PITRM1 n/a
7 TRCN0000052239 GCAGTATAAACTAGGAGACAA pLKO.1 154 3UTR 100% 4.950 3.465 N PITRM1 n/a
8 TRCN0000052238 GCACGTTTGATGACTGCCAAA pLKO.1 2803 3UTR 100% 4.050 2.835 N PITRM1 n/a
9 TRCN0000288804 GCACGTTTGATGACTGCCAAA pLKO_005 2803 3UTR 100% 4.050 2.835 N PITRM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001747004.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15717 pDONR223 0% 77.2% None (many diffs) n/a
2 ccsbBroad304_15717 pLX_304 0% 77.2% V5 (many diffs) n/a
3 TRCN0000471723 AACCCAGACTCCGGGTGATACACA pLX_317 11.7% 77.2% V5 (many diffs) n/a
4 TRCN0000478736 ACCTAGGCACAACGCTACTCATCA pLX_317 28.9% 37.2% V5 (many diffs) n/a
5 ccsbBroadEn_11517 pDONR223 100% 37.2% None (many diffs) n/a
6 ccsbBroad304_11517 pLX_304 0% 37.2% V5 (many diffs) n/a
Download CSV