Transcript: Human XR_001747203.2

PREDICTED: Homo sapiens PDZ domain containing 7 (PDZD7), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PDZD7 (79955)
Length:
3216
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001747203.2
NBCI Gene record:
PDZD7 (79955)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001747203.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144066 CAACAGTGATGAAAGTGACAT pLKO.1 466 3UTR 100% 4.950 3.465 N PDZD7 n/a
2 TRCN0000122365 CTGGGCATCTATGTGTCCAAA pLKO.1 938 3UTR 100% 4.950 3.465 N PDZD7 n/a
3 TRCN0000140413 GACGCTGATGAACCTCTTCTT pLKO.1 1633 3UTR 100% 4.950 3.465 N PDZD7 n/a
4 TRCN0000139457 CAAGACGCTGATGAACCTCTT pLKO.1 1630 3UTR 100% 4.050 2.835 N PDZD7 n/a
5 TRCN0000140506 GTATCCTGCCTACAAGGAGAT pLKO.1 1117 3UTR 100% 4.050 2.835 N PDZD7 n/a
6 TRCN0000139125 CCAATCCCAACTACTCTGGAA pLKO.1 2042 3UTR 100% 2.640 1.848 N PDZD7 n/a
7 TRCN0000140082 GCCTACAAGGAGATGGTTTCT pLKO.1 1124 3UTR 100% 4.950 2.970 N PDZD7 n/a
8 TRCN0000141876 GCTGATGAACCTCTTCTTCAA pLKO.1 1636 3UTR 100% 4.950 2.970 N PDZD7 n/a
9 TRCN0000139583 CATCTTCGTCAGCAAAGTGGA pLKO.1 568 3UTR 100% 2.640 1.584 N PDZD7 n/a
10 TRCN0000140238 GTCTCCCAAAGTGCTAGGATT pLKO.1 1998 3UTR 100% 4.950 2.475 Y PDZD7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001747203.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14276 pDONR223 100% 47.6% None (many diffs) n/a
2 ccsbBroad304_14276 pLX_304 0% 47.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000479509 CTTACGGTTTCCACAAAGGTCACC pLX_317 17.6% 47.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV