Transcript: Human XR_001747839.1

PREDICTED: Homo sapiens prolyl 4-hydroxylase subunit alpha 3 (P4HA3), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
P4HA3 (283208)
Length:
1609
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001747839.1
NBCI Gene record:
P4HA3 (283208)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001747839.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064768 GCCAGGAATGTCTTGAAATAT pLKO.1 530 3UTR 100% 15.000 10.500 N P4HA3 n/a
2 TRCN0000428660 CACTTGGCCTTTGCTTATTTC pLKO_005 434 3UTR 100% 13.200 9.240 N P4HA3 n/a
3 TRCN0000425195 AGTCTCTTCCGAGGATCTTAC pLKO_005 365 3UTR 100% 10.800 7.560 N P4HA3 n/a
4 TRCN0000064772 GTGGCCAACAAGTGGATACAT pLKO.1 1520 3UTR 100% 5.625 3.938 N P4HA3 n/a
5 TRCN0000064771 CCTAGCCTCTACTGTTCCTAT pLKO.1 692 3UTR 100% 4.950 3.465 N P4HA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001747839.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489677 GATCCTCGCTGGTCCGTACAACAA pLX_317 24.5% 71.2% V5 (many diffs) n/a
2 TRCN0000488796 GAGGTACCTGTGTTACCTTATACA pLX_317 21.1% 71.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_05351 pDONR223 100% 71.3% None (many diffs) n/a
4 ccsbBroad304_05351 pLX_304 0% 71.3% V5 (many diffs) n/a
5 TRCN0000468375 GCCGCGCTATGGAGGCTTTGTAGT pLX_317 28% 71.3% V5 (many diffs) n/a
6 ccsbBroadEn_16145 pDONR223 0% 71.2% None (many diffs) n/a
7 ccsbBroad304_16145 pLX_304 0% 71.2% V5 (many diffs) n/a
8 TRCN0000480866 ACATAATCAGAGATTATTCCTTTT pLX_317 43.6% 38.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV