Transcript: Human XR_001747840.1

PREDICTED: Homo sapiens prolyl 4-hydroxylase subunit alpha 3 (P4HA3), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
P4HA3 (283208)
Length:
2111
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001747840.1
NBCI Gene record:
P4HA3 (283208)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001747840.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064769 CCTGACTAGATTCTACGACAA pLKO.1 235 3UTR 100% 4.050 5.670 N P4HA3 n/a
2 TRCN0000064768 GCCAGGAATGTCTTGAAATAT pLKO.1 833 3UTR 100% 15.000 10.500 N P4HA3 n/a
3 TRCN0000428660 CACTTGGCCTTTGCTTATTTC pLKO_005 737 3UTR 100% 13.200 9.240 N P4HA3 n/a
4 TRCN0000423581 AGGCAAGGGAGAGGTTGTTAC pLKO_005 1658 3UTR 100% 10.800 7.560 N P4HA3 n/a
5 TRCN0000425195 AGTCTCTTCCGAGGATCTTAC pLKO_005 668 3UTR 100% 10.800 7.560 N P4HA3 n/a
6 TRCN0000064772 GTGGCCAACAAGTGGATACAT pLKO.1 1447 3UTR 100% 5.625 3.938 N P4HA3 n/a
7 TRCN0000064771 CCTAGCCTCTACTGTTCCTAT pLKO.1 995 3UTR 100% 4.950 3.465 N P4HA3 n/a
8 TRCN0000064770 GCTTGCATTTACTCTCATCAA pLKO.1 304 3UTR 100% 4.950 3.465 N P4HA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001747840.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488796 GAGGTACCTGTGTTACCTTATACA pLX_317 21.1% 65.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489677 GATCCTCGCTGGTCCGTACAACAA pLX_317 24.5% 64.8% V5 1_43del;1217_1218ins160;1516_2111delinsG n/a
3 ccsbBroadEn_16145 pDONR223 0% 64.8% None 1_43del;1217_1218ins160;1516_2111del n/a
4 ccsbBroad304_16145 pLX_304 0% 64.8% V5 1_43del;1217_1218ins160;1516_2111del n/a
5 TRCN0000480866 ACATAATCAGAGATTATTCCTTTT pLX_317 43.6% 47.9% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_05351 pDONR223 100% 64.8% None 1_43del;1217_1218ins160;1516_2111del n/a
7 ccsbBroad304_05351 pLX_304 0% 64.8% V5 1_43del;1217_1218ins160;1516_2111del n/a
8 TRCN0000468375 GCCGCGCTATGGAGGCTTTGTAGT pLX_317 28% 64.8% V5 1_43del;1217_1218ins160;1516_2111del n/a
Download CSV