Transcript: Human XR_001748011.2

PREDICTED: Homo sapiens transforming growth factor beta regulator 1 (TBRG1), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TBRG1 (84897)
Length:
5357
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001748011.2
NBCI Gene record:
TBRG1 (84897)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001748011.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373593 CTATTGCAGTACTCGAATATA pLKO_005 1080 3UTR 100% 15.000 21.000 N TBRG1 n/a
2 TRCN0000373592 ATCTTGTAATCGGGATGTAAT pLKO_005 1885 3UTR 100% 13.200 18.480 N TBRG1 n/a
3 TRCN0000307585 CAATTACCAGTGGGTGAAATT pLKO_005 1380 3UTR 100% 13.200 9.240 N Tbrg1 n/a
4 TRCN0000016914 CCAGACCAGAAGTGTCTATAT pLKO.1 1117 3UTR 100% 13.200 9.240 N TBRG1 n/a
5 TRCN0000373594 TACAGGGAGCTGGGCCTATTT pLKO_005 568 3UTR 100% 13.200 9.240 N TBRG1 n/a
6 TRCN0000016917 GAGGAACCATTTGGGAAGAAA pLKO.1 609 3UTR 100% 5.625 3.938 N TBRG1 n/a
7 TRCN0000016916 GCAGATGCTTGTCATGCAGAA pLKO.1 1225 3UTR 100% 4.050 2.835 N TBRG1 n/a
8 TRCN0000016913 CCCATGTACCTGACACATGAA pLKO.1 1579 3UTR 100% 0.495 0.347 N TBRG1 n/a
9 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3515 3UTR 100% 4.950 2.475 Y ERAP2 n/a
10 TRCN0000016915 GAGAACAACAAACTGGAAGAT pLKO.1 660 3UTR 100% 4.950 3.465 N TBRG1 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3516 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001748011.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12875 pDONR223 100% 10.4% None 1_1107del;1669_5357del n/a
2 ccsbBroad304_12875 pLX_304 0% 10.4% V5 1_1107del;1669_5357del n/a
3 ccsbBroadEn_10274 pDONR223 100% 7.6% None (many diffs) n/a
4 ccsbBroad304_10274 pLX_304 0% 7.6% V5 (many diffs) n/a
5 TRCN0000465708 ACATTACCATATTGCCCGAATTGG pLX_317 85.4% 7.6% V5 (many diffs) n/a
6 ccsbBroadEn_16048 pDONR223 0% 5.2% None (many diffs) n/a
7 ccsbBroad304_16048 pLX_304 0% 5.2% V5 (many diffs) n/a
8 TRCN0000470599 TTCGCAATTGCGATCACTTTCTTC pLX_317 52.6% 5.2% V5 (many diffs) n/a
Download CSV