Transcript: Human XR_001748600.2

PREDICTED: Homo sapiens F-box and leucine rich repeat protein 14 (FBXL14), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FBXL14 (144699)
Length:
8542
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001748600.2
NBCI Gene record:
FBXL14 (144699)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001748600.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245551 CATGGTTCCCGTGGATCTTTA pLKO_005 1453 3UTR 100% 13.200 9.240 N FBXL14 n/a
2 TRCN0000245550 ACCAGAGTCTGGCTTACATAG pLKO_005 1005 3UTR 100% 10.800 7.560 N FBXL14 n/a
3 TRCN0000257448 CCAGAAGCTCACAGATCTTTC pLKO_005 760 3UTR 100% 10.800 7.560 N FBXL14 n/a
4 TRCN0000180800 GCCAGAAGCTCACAGATCTTT pLKO.1 759 3UTR 100% 5.625 3.938 N FBXL14 n/a
5 TRCN0000245553 TGCGCTCCTGTGACAACATCA pLKO_005 903 3UTR 100% 4.950 3.465 N FBXL14 n/a
6 TRCN0000146746 CTCCATTATTCACTGTGAGAA pLKO.1 1392 3UTR 100% 4.950 2.970 N FBXL14 n/a
7 TRCN0000245552 CTGCTACAACCTCACCGACAA pLKO_005 421 3UTR 100% 4.050 2.430 N FBXL14 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5417 3UTR 100% 4.950 2.475 Y KAAG1 n/a
9 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 7371 3UTR 100% 4.050 2.025 Y Mtif2 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3485 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3485 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001748600.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09614 pDONR223 100% 14.5% None (many diffs) n/a
2 ccsbBroad304_09614 pLX_304 0% 14.5% V5 (many diffs) n/a
3 TRCN0000467182 AGCTGAGAAGCTCAGATATCAATT pLX_317 22.6% 14.5% V5 (many diffs) n/a
4 ccsbBroadEn_12783 pDONR223 100% 2.1% None (many diffs) n/a
5 ccsbBroad304_12783 pLX_304 0% 2.1% V5 (many diffs) n/a
6 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 2.1% V5 (many diffs) n/a
7 ccsbBroadEn_10261 pDONR223 100% .7% None (many diffs) n/a
8 ccsbBroad304_10261 pLX_304 0% .7% V5 (many diffs) n/a
9 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% .7% V5 (many diffs) n/a
Download CSV