Transcript: Human XR_001748697.2

PREDICTED: Homo sapiens killer cell lectin like receptor D1 (KLRD1), transcript variant X11, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KLRD1 (3824)
Length:
2913
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001748697.2
NBCI Gene record:
KLRD1 (3824)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001748697.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416718 AGAACTGCATAGCGTATAATC pLKO_005 2512 3UTR 100% 13.200 18.480 N KLRD1 n/a
2 TRCN0000057409 CCGGTGCAACTGTTACTTCAT pLKO.1 2264 3UTR 100% 4.950 6.930 N KLRD1 n/a
3 TRCN0000057410 CCTTAGGGATAATATGCCTTT pLKO.1 2104 3UTR 100% 4.050 5.670 N KLRD1 n/a
4 TRCN0000057411 CCAGTATCTATTTCCATCATT pLKO.1 2474 3UTR 100% 5.625 3.938 N KLRD1 n/a
5 TRCN0000057408 CCCAACATAGAACTCCAGAAA pLKO.1 2202 3UTR 100% 4.950 3.465 N KLRD1 n/a
6 TRCN0000165774 CCTCCTAAGTAGCTGGGATTA pLKO.1 1379 3UTR 100% 10.800 5.400 Y SNX29P1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001748697.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00911 pDONR223 100% 18% None (many diffs) n/a
2 ccsbBroad304_00911 pLX_304 0% 18% V5 (many diffs) n/a
3 ccsbBroadEn_12783 pDONR223 100% 6.4% None (many diffs) n/a
4 ccsbBroad304_12783 pLX_304 0% 6.4% V5 (many diffs) n/a
5 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 6.4% V5 (many diffs) n/a
6 ccsbBroadEn_10261 pDONR223 100% 2.1% None (many diffs) n/a
7 ccsbBroad304_10261 pLX_304 0% 2.1% V5 (many diffs) n/a
8 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% 2.1% V5 (many diffs) n/a
Download CSV