Transcript: Human XR_001749669.2

PREDICTED: Homo sapiens N(alpha)-acetyltransferase 16, NatA auxiliary subunit (NAA16), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NAA16 (79612)
Length:
4457
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001749669.2
NBCI Gene record:
NAA16 (79612)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001749669.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060607 CCAAAGCAATTACACCCAGAA pLKO.1 1153 3UTR 100% 4.050 5.670 N NAA16 n/a
2 TRCN0000060604 GCTCTACAAATTAGCACTTTA pLKO.1 1089 3UTR 100% 13.200 9.240 N NAA16 n/a
3 TRCN0000060605 CGCATCTTGAAATGTTATGAA pLKO.1 336 3UTR 100% 5.625 3.938 N NAA16 n/a
4 TRCN0000060606 GCATACCATTTGCTGAAAGAT pLKO.1 759 3UTR 100% 5.625 3.938 N NAA16 n/a
5 TRCN0000060603 GCCCTCAAATTAGATAAAGAT pLKO.1 606 3UTR 100% 5.625 3.938 N NAA16 n/a
6 TRCN0000114634 CCATACATACTGCATGAGAAA pLKO.1 2008 3UTR 100% 4.950 3.465 N Naa16 n/a
7 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 3453 3UTR 100% 4.950 2.475 Y CFLAR n/a
8 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 3453 3UTR 100% 4.950 2.475 Y C19orf31 n/a
9 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 3451 3UTR 100% 4.950 2.475 Y ERN2 n/a
10 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 3451 3UTR 100% 4.950 2.475 Y P3H4 n/a
11 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 3451 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001749669.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14262 pDONR223 100% 28.6% None (many diffs) n/a
2 ccsbBroad304_14262 pLX_304 0% 28.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_12572 pDONR223 100% 22.5% None 1_2020del;3026_4457del n/a
4 ccsbBroad304_12572 pLX_304 0% 22.5% V5 1_2020del;3026_4457del n/a
5 TRCN0000470589 GGCGGTACAATTCCTCGGTGTCAA pLX_317 33.6% 22.5% V5 1_2020del;3026_4457del n/a
6 ccsbBroadEn_15984 pDONR223 0% 20.9% None (many diffs) n/a
7 ccsbBroad304_15984 pLX_304 0% 20.9% V5 (many diffs) n/a
Download CSV