Transcript: Human XR_001749878.2

PREDICTED: Homo sapiens transmembrane phosphoinositide 3-phosphatase and tensin homolog 2 pseudogene 2 (TPTE2P2), misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TPTE2P2 (644623)
Length:
2583
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001749878.2
NBCI Gene record:
TPTE2P2 (644623)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001749878.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052829 CGAATGAATTGACAACAGCAA pLKO.1 78 3UTR 100% 2.640 3.696 N TPTE2P3 n/a
2 TRCN0000052830 CCTTAAAGAATTGTCGGGTAT pLKO.1 1414 3UTR 100% 4.050 2.835 N TPTE2P3 n/a
3 TRCN0000052831 GCTCTGATCTTTGCTGACCTA pLKO.1 380 3UTR 100% 2.640 1.320 Y TPTE2P3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001749878.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07096 pDONR223 100% 52.8% None (many diffs) n/a
2 ccsbBroad304_07096 pLX_304 0% 52.8% V5 (many diffs) n/a
3 ccsbBroadEn_09359 pDONR223 100% 41.1% None (many diffs) n/a
4 ccsbBroad304_09359 pLX_304 0% 41.1% V5 (many diffs) n/a
5 TRCN0000476938 CCCCATGTCTGGCCCGTCAAGACC pLX_317 35.7% 41.1% V5 (many diffs) n/a
Download CSV