Transcript: Human XR_001751355.2

PREDICTED: Homo sapiens mitogen-activated protein kinase kinase 5 (MAP2K5), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP2K5 (5607)
Length:
1621
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001751355.2
NBCI Gene record:
MAP2K5 (5607)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001751355.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001467 GCCCTCCAATATGCTAGTAAA pLKO.1 1457 3UTR 100% 13.200 18.480 N MAP2K5 n/a
2 TRCN0000197077 GCTGGTAATTCGCATCAAGAT pLKO.1 699 3UTR 100% 4.950 6.930 N MAP2K5 n/a
3 TRCN0000320675 GCTGGTAATTCGCATCAAGAT pLKO_005 699 3UTR 100% 4.950 6.930 N MAP2K5 n/a
4 TRCN0000196513 GCTGTAAAGGTCATACTACTA pLKO.1 1228 3UTR 100% 4.950 3.960 N MAP2K5 n/a
5 TRCN0000320679 ATGAAGATGGTGATCGAATTA pLKO_005 842 3UTR 100% 13.200 9.240 N MAP2K5 n/a
6 TRCN0000199800 GAGAACCAGGTGCTGGTAATT pLKO.1 688 3UTR 100% 13.200 9.240 N MAP2K5 n/a
7 TRCN0000001469 CCAATATGCTAGTAAACACAA pLKO.1 1462 3UTR 100% 4.950 3.465 N MAP2K5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001751355.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01290 pDONR223 100% 48.6% None 1_651del;1449_1450ins49;1621_1622ins325 n/a
2 ccsbBroad304_01290 pLX_304 0% 48.6% V5 1_651del;1449_1450ins49;1621_1622ins325 n/a
3 ccsbBroadEn_14809 pDONR223 0% 48.6% None 1_651del;1449_1450ins49;1621_1622ins325 n/a
4 ccsbBroad304_14809 pLX_304 0% 48.6% V5 1_651del;1449_1450ins49;1621_1622ins325 n/a
5 TRCN0000465680 AGGTGACCTATTCTTTCAGAAATC pLX_317 20.8% 48.6% V5 1_651del;1449_1450ins49;1621_1622ins325 n/a
6 TRCN0000488580 TGTTTACCTTTCTAAGTGAGACGG pLX_317 20.9% 48.6% V5 (not translated due to prior stop codon) 1_651del;1449_1450ins49;1621_1622ins325 n/a
Download CSV