Transcript: Human XR_001752445.2

PREDICTED: Homo sapiens folliculin (FLCN), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FLCN (201163)
Length:
2221
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001752445.2
NBCI Gene record:
FLCN (201163)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001752445.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000237886 GATGGAGAAGCTCGCTGATTT pLKO_005 1413 3UTR 100% 13.200 18.480 N FLCN n/a
2 TRCN0000237885 CTCTCAGCAAGTACGAGTTTG pLKO_005 1810 3UTR 100% 10.800 15.120 N FLCN n/a
3 TRCN0000005969 CCGGGATATATCAGCCATGAT pLKO.1 781 3UTR 100% 4.950 6.930 N FLCN n/a
4 TRCN0000005970 GACCTACAAGTCACACCTCAT pLKO.1 2111 3UTR 100% 4.050 5.670 N FLCN n/a
5 TRCN0000005971 CATTCAGATGAACAGTCGGAT pLKO.1 657 3UTR 100% 2.640 3.696 N FLCN n/a
6 TRCN0000237884 GATAAAGAGACCTCCATTAAA pLKO_005 799 3UTR 100% 15.000 10.500 N FLCN n/a
7 TRCN0000237883 CCACCATCCTGAATAAGATTG pLKO_005 1873 3UTR 100% 10.800 7.560 N FLCN n/a
8 TRCN0000010979 CCCACCATCCTGAATAAGATT pLKO.1 1872 3UTR 100% 5.625 3.938 N FLCN n/a
9 TRCN0000304275 GCCACACCTTCTTCATCAAAG pLKO_005 1016 3UTR 100% 10.800 7.560 N Flcn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001752445.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05196 pDONR223 100% 42.8% None (many diffs) n/a
2 ccsbBroad304_05196 pLX_304 0% 42.8% V5 (many diffs) n/a
3 TRCN0000472641 TAACTCGCTGGCCTCAAAGCATTC pLX_317 39.5% 42.8% V5 (many diffs) n/a
Download CSV