Transcript: Human XR_001752557.1

PREDICTED: Homo sapiens NPL4 homolog, ubiquitin recognition factor (NPLOC4), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NPLOC4 (55666)
Length:
7851
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001752557.1
NBCI Gene record:
NPLOC4 (55666)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001752557.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338872 CGGAAGGTTGGCTGGATATTT pLKO_005 1134 3UTR 100% 15.000 21.000 N NPLOC4 n/a
2 TRCN0000338873 CGTCCGCTACAGTCGAAATAA pLKO_005 1190 3UTR 100% 15.000 21.000 N NPLOC4 n/a
3 TRCN0000350998 ATTCGATGAGGACTATCTAAA pLKO_005 656 3UTR 100% 13.200 18.480 N NPLOC4 n/a
4 TRCN0000153383 GCATTGGCGATTTGTCTGATT pLKO.1 7380 3UTR 100% 4.950 6.930 N NPLOC4 n/a
5 TRCN0000152140 CCTATTTGTCTCAGAATACCT pLKO.1 1702 3UTR 100% 3.000 2.400 N NPLOC4 n/a
6 TRCN0000338874 CCACCCAGCCTTCTCTTTATT pLKO_005 5826 3UTR 100% 15.000 10.500 N NPLOC4 n/a
7 TRCN0000153073 GCTGAAGTGGTCGATGAAATT pLKO.1 1095 3UTR 100% 13.200 9.240 N NPLOC4 n/a
8 TRCN0000152941 GACAACCAAGTCCACTTTGAA pLKO.1 1362 3UTR 100% 5.625 3.938 N NPLOC4 n/a
9 TRCN0000150649 GCACTATGAACAGAGAACATT pLKO.1 6809 3UTR 100% 5.625 3.938 N NPLOC4 n/a
10 TRCN0000158228 CCTGACAACCAAGTCCACTTT pLKO.1 1359 3UTR 100% 4.950 3.465 N NPLOC4 n/a
11 TRCN0000338871 CCTGACAACCAAGTCCACTTT pLKO_005 1359 3UTR 100% 4.950 3.465 N NPLOC4 n/a
12 TRCN0000152847 GCGATTTGTCTGATTCTGGTT pLKO.1 7386 3UTR 100% 2.640 1.848 N NPLOC4 n/a
13 TRCN0000215673 GAACATCAGCTGCAAGATTAA pLKO.1 770 3UTR 100% 13.200 7.920 N Nploc4 n/a
14 TRCN0000153539 CCACATTCTTGGCACTATGAA pLKO.1 6798 3UTR 100% 5.625 3.375 N NPLOC4 n/a
15 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 2529 3UTR 100% 4.950 2.475 Y CFLAR n/a
16 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 2529 3UTR 100% 4.950 2.475 Y C19orf31 n/a
17 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 4645 3UTR 100% 4.950 2.475 Y ERAP2 n/a
18 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4646 3UTR 100% 13.200 6.600 Y LIAS n/a
19 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3888 3UTR 100% 5.625 2.813 Y KLHL30 n/a
20 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 2527 3UTR 100% 4.950 2.475 Y ERN2 n/a
21 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 2527 3UTR 100% 4.950 2.475 Y P3H4 n/a
22 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 2527 3UTR 100% 4.950 2.475 Y P3H4 n/a
23 TRCN0000157407 GATCTCGGCTTACTGCAACTT pLKO.1 5205 3UTR 100% 4.950 2.475 Y GTF2IRD2B n/a
24 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3888 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001752557.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10261 pDONR223 100% .8% None (many diffs) n/a
2 ccsbBroad304_10261 pLX_304 0% .8% V5 (many diffs) n/a
3 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% .8% V5 (many diffs) n/a
Download CSV