Transcript: Human XR_001752910.2

PREDICTED: Homo sapiens uncharacterized LOC105369225 (LOC105369225), transcript variant X1, ncRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC105369225 (105369225)
Length:
1015
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001752910.2
NBCI Gene record:
LOC105369225 (105369225)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001752910.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344481 AGCAGCGGTTTCCCAAGTTTC pLKO_005 579 3UTR 100% 10.800 5.400 Y ARL17B n/a
2 TRCN0000371106 GAATGTGGAAAGGAGGTAGAA pLKO_005 448 3UTR 100% 4.950 2.475 Y ARL17B n/a
3 TRCN0000263039 TGGTCAGCTGGACTCCATACT pLKO_005 512 3UTR 100% 4.950 2.475 Y ARL17B n/a
4 TRCN0000139147 CCCATCTCTTGGACAGATGAT pLKO.1 732 3UTR 100% 0.495 0.248 Y ARL17A n/a
5 TRCN0000166030 CCTCTGGAAATCAGCTGTGTT pLKO.1 614 3UTR 100% 4.950 2.475 Y NBR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001752910.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11975 pDONR223 100% 38.5% None (many diffs) n/a
2 ccsbBroad304_11975 pLX_304 0% 38.5% V5 (many diffs) n/a
3 TRCN0000472181 ATTATGTTATCGCGATTGCCACTT pLX_317 93.6% 38.5% V5 (many diffs) n/a
4 ccsbBroadEn_14147 pDONR223 100% 21.3% None (many diffs) n/a
5 ccsbBroad304_14147 pLX_304 0% 21.3% V5 (many diffs) n/a
6 TRCN0000472660 ACATCAACTGCAGGATTCTATGTG pLX_317 100% 21.3% V5 (many diffs) n/a
7 ccsbBroadEn_11473 pDONR223 100% 17.7% None (many diffs) n/a
8 ccsbBroad304_11473 pLX_304 0% 17.7% V5 (many diffs) n/a
9 TRCN0000479820 CGTGGTACGCCAGCATATGCCAGA pLX_317 100% 17.7% V5 (many diffs) n/a
Download CSV