Transcript: Human XR_001753204.2

PREDICTED: Homo sapiens phosphatidylinositol 3-kinase catalytic subunit type 3 (PIK3C3), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PIK3C3 (5289)
Length:
6185
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001753204.2
NBCI Gene record:
PIK3C3 (5289)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001753204.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196840 GAGATGTACTTGAACGTAATG pLKO.1 1764 3UTR 100% 10.800 15.120 N PIK3C3 n/a
2 TRCN0000296101 GAGATGTACTTGAACGTAATG pLKO_005 1764 3UTR 100% 10.800 15.120 N PIK3C3 n/a
3 TRCN0000037797 CGGTGATGAATCATCTCCAAT pLKO.1 938 3UTR 100% 4.950 3.960 N PIK3C3 n/a
4 TRCN0000037794 CCACGAGAGATCAGTTAAATA pLKO.1 1093 3UTR 100% 15.000 10.500 N PIK3C3 n/a
5 TRCN0000196290 GAGGCAAATATCCAGTTATAT pLKO.1 2104 3UTR 100% 15.000 10.500 N PIK3C3 n/a
6 TRCN0000196708 GCTGGATAGATTGACATTTAG pLKO.1 797 3UTR 100% 13.200 9.240 N PIK3C3 n/a
7 TRCN0000296151 GCTGGATAGATTGACATTTAG pLKO_005 797 3UTR 100% 13.200 9.240 N PIK3C3 n/a
8 TRCN0000196707 GTTGAAGTTCTCAGGACTATA pLKO.1 187 3UTR 100% 13.200 9.240 N PIK3C3 n/a
9 TRCN0000310259 GTTGAAGTTCTCAGGACTATA pLKO_005 187 3UTR 100% 13.200 9.240 N PIK3C3 n/a
10 TRCN0000037795 CCAAGTGAGAATGGGCCAAAT pLKO.1 2346 3UTR 100% 10.800 7.560 N PIK3C3 n/a
11 TRCN0000289015 CCAAGTGAGAATGGGCCAAAT pLKO_005 2346 3UTR 100% 10.800 7.560 N PIK3C3 n/a
12 TRCN0000037798 GCTGCACAACAGACATTTGTA pLKO.1 1848 3UTR 100% 5.625 3.938 N PIK3C3 n/a
13 TRCN0000196247 GCAACCTTTGTATATTGGAGA pLKO.1 2770 3UTR 100% 2.640 1.848 N PIK3C3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001753204.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491942 CCTATCCGGCCGAGTTACGAGTCC pLX_317 14.6% 39.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14758 pDONR223 60.7% 39% None (many diffs) n/a
3 ccsbBroad304_14758 pLX_304 0% 39% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000475007 AATCTTGGTAACTGTATGAATAAA pLX_317 19% 39% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV