Transcript: Human XR_001754830.1

PREDICTED: Homo sapiens N-6 adenine-specific DNA methyltransferase 1 (N6AMT1), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
N6AMT1 (29104)
Length:
1685
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001754830.1
NBCI Gene record:
N6AMT1 (29104)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001754830.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038755 CCTTTCACCAAGAGGATTATT pLKO.1 506 3UTR 100% 15.000 10.500 N N6AMT1 n/a
2 TRCN0000038756 GTTGATCTTCTGGTGTTTAAT pLKO.1 366 3UTR 100% 15.000 10.500 N N6AMT1 n/a
3 TRCN0000038758 GTTCACATTCAACCAGTTATT pLKO.1 303 3UTR 100% 13.200 9.240 N N6AMT1 n/a
4 TRCN0000434624 GTACATGTGCACTGATATCAA pLKO_005 236 3UTR 100% 5.625 3.938 N N6AMT1 n/a
5 TRCN0000038754 CGCTGTAACAAAGTTCACATT pLKO.1 291 3UTR 100% 4.950 3.465 N N6AMT1 n/a
6 TRCN0000038757 AGAAACTCTTTCAGTCCTCAA pLKO.1 629 3UTR 100% 4.050 2.835 N N6AMT1 n/a
7 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1416 3UTR 100% 4.950 2.475 Y ERAP2 n/a
8 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 1455 3UTR 100% 4.050 2.025 Y P3H4 n/a
9 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 1455 3UTR 100% 4.050 2.025 Y ORAI2 n/a
10 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 1455 3UTR 100% 4.050 2.025 Y P3H4 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1417 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001754830.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488018 TGTTATTATCCGGTGTACCCGTGT pLX_317 56.7% 33% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV