Transcript: Human XR_001755632.2

PREDICTED: Homo sapiens histone deacetylase 6 (HDAC6), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HDAC6 (10013)
Length:
3925
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001755632.2
NBCI Gene record:
HDAC6 (10013)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001755632.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314908 CTCACTGATCAGGCCATATTT pLKO_005 3205 3UTR 100% 15.000 21.000 N HDAC6 n/a
2 TRCN0000314910 GTCACTTCGAAGCGAAATATT pLKO_005 191 3UTR 100% 15.000 21.000 N HDAC6 n/a
3 TRCN0000314909 TATCCTAGAGGGTGGCTATAA pLKO_005 2241 3UTR 100% 13.200 18.480 N HDAC6 n/a
4 TRCN0000380796 CCCAATCTAGCGGAGGTAAAG pLKO_005 239 3UTR 100% 10.800 15.120 N HDAC6 n/a
5 TRCN0000381582 GAGGGTCCTTATCGTAGATTG pLKO_005 841 3UTR 100% 10.800 15.120 N HDAC6 n/a
6 TRCN0000199967 CGGAGGGTCCTTATCGTAGAT pLKO.1 839 3UTR 100% 4.950 6.930 N HDAC6 n/a
7 TRCN0000004842 CGGTAATGGAACTCAGCACAT pLKO.1 2062 3UTR 100% 4.050 5.670 N HDAC6 n/a
8 TRCN0000350401 CGGTAATGGAACTCAGCACAT pLKO_005 2062 3UTR 100% 4.050 5.670 N HDAC6 n/a
9 TRCN0000194771 CAACTTTGACTCCATCTATAT pLKO.1 1798 3UTR 100% 13.200 9.240 N HDAC6 n/a
10 TRCN0000004843 CCTCACTGATCAGGCCATATT pLKO.1 3204 3UTR 100% 13.200 9.240 N HDAC6 n/a
11 TRCN0000004839 CATCCCATCCTGAATATCCTT pLKO.1 3660 3UTR 100% 3.000 2.100 N HDAC6 n/a
12 TRCN0000314976 CATCCCATCCTGAATATCCTT pLKO_005 3660 3UTR 100% 3.000 2.100 N HDAC6 n/a
13 TRCN0000004841 GCACAGTCTTATGGATGGCTA pLKO.1 760 3UTR 100% 2.640 1.848 N HDAC6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001755632.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489770 GAAGAAAACACCGAGAGAACTGCA pLX_317 9.4% 83.8% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_11446 pDONR223 100% 72.7% None 1_562del;2098_2099ins193;3559_3925del n/a
3 ccsbBroad304_11446 pLX_304 0% 72.7% V5 1_562del;2098_2099ins193;3559_3925del n/a
4 TRCN0000471558 GAAAAATATGGGGCTTAAGGCGCA pLX_317 13.3% 72.7% V5 1_562del;2098_2099ins193;3559_3925del n/a
5 ccsbBroadEn_11445 pDONR223 100% 11.1% None 1_106del;544_3925delinsG n/a
6 ccsbBroad304_11445 pLX_304 0% 11.1% V5 1_106del;544_3925delinsG n/a
7 TRCN0000473847 ACACTGCCCGTATTCTGTATTAAG pLX_317 77.9% 11.1% V5 1_106del;544_3925delinsG n/a
Download CSV