Transcript: Human XR_001755703.1

PREDICTED: Homo sapiens gem nuclear organelle associated protein 8 (GEMIN8), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GEMIN8 (54960)
Length:
2054
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001755703.1
NBCI Gene record:
GEMIN8 (54960)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001755703.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245429 TCAATCTTCCATGGTACTTAC pLKO_005 406 3UTR 100% 10.800 7.560 N GEMIN8 n/a
2 TRCN0000245433 AGAATGTGACCTGAGCAATAT pLKO_005 647 3UTR 100% 13.200 7.920 N GEMIN8 n/a
3 TRCN0000245430 TGGTATTCTCATCCGGTATAT pLKO_005 300 3UTR 100% 13.200 7.920 N GEMIN8 n/a
4 TRCN0000245431 CCCAAAGCTCTTACGATAATG pLKO_005 442 3UTR 100% 13.200 6.600 Y GEMIN8 n/a
5 TRCN0000256745 CAGCCTGGCCAACATGGTAAA pLKO_005 1832 3UTR 100% 10.800 5.400 Y SMIM11A n/a
6 TRCN0000172578 GAGTCAGATGCAGAGGTAGAA pLKO.1 630 3UTR 100% 4.950 2.475 Y GEMIN8 n/a
7 TRCN0000172300 CCTCAGTCCTTCTATGACCAT pLKO.1 474 3UTR 100% 2.640 1.320 Y GEMIN8 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1065 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001755703.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03498 pDONR223 100% 35.3% None 1_257del;984_2054del n/a
2 ccsbBroad304_03498 pLX_304 0% 35.3% V5 1_257del;984_2054del n/a
3 TRCN0000478773 ATCGAATATGCTTTACAGGTTTAA pLX_317 48.5% 35.3% V5 1_257del;984_2054del n/a
4 ccsbBroadEn_10393 pDONR223 100% 16.2% None (many diffs) n/a
5 ccsbBroad304_10393 pLX_304 0% 16.2% V5 (many diffs) n/a
6 TRCN0000481382 GTGCCCAGTTAGCGTCGAGCGGCC pLX_317 100% 16.2% V5 (many diffs) n/a
Download CSV