Transcript: Mouse XR_001782063.1

PREDICTED: Mus musculus tuberous sclerosis 2 (Tsc2), transcript variant X14, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tsc2 (22084)
Length:
5191
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782063.1
NBCI Gene record:
Tsc2 (22084)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782063.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042725 CCCTTATATCACTAAGGGTTT pLKO.1 2843 3UTR 100% 0.405 0.567 N Tsc2 n/a
2 TRCN0000042724 CCTCTCTCTTAAACTTGATAT pLKO.1 1378 3UTR 100% 13.200 10.560 N Tsc2 n/a
3 TRCN0000326277 CCTCTCTCTTAAACTTGATAT pLKO_005 1378 3UTR 100% 13.200 10.560 N Tsc2 n/a
4 TRCN0000042726 GCAGCCTATGTGCCTTTGTTA pLKO.1 3666 3UTR 100% 5.625 3.938 N Tsc2 n/a
5 TRCN0000042727 CGAGTGTATGAGAGCCTCATT pLKO.1 1869 3UTR 100% 4.950 3.465 N Tsc2 n/a
6 TRCN0000326275 CGAGTGTATGAGAGCCTCATT pLKO_005 1869 3UTR 100% 4.950 3.465 N Tsc2 n/a
7 TRCN0000042723 GCCCGATATGTGTTCTCCAAT pLKO.1 3207 3UTR 100% 4.950 3.465 N Tsc2 n/a
8 TRCN0000326276 GCCCGATATGTGTTCTCCAAT pLKO_005 3207 3UTR 100% 4.950 3.465 N Tsc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782063.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07101 pDONR223 100% 77.1% None (many diffs) n/a
2 ccsbBroad304_07101 pLX_304 12.7% 77.1% V5 (many diffs) n/a
3 TRCN0000476551 CGGAATCACTATGTGAGCATTTTA pLX_317 7.2% 77.1% V5 (many diffs) n/a
Download CSV