Transcript: Mouse XR_001782390.1

PREDICTED: Mus musculus RIO kinase 3 (Riok3), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Riok3 (66878)
Length:
5754
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782390.1
NBCI Gene record:
Riok3 (66878)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782390.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023871 CCAAGCATGATGAAGTAGTAT pLKO.1 3177 3UTR 100% 5.625 3.938 N Riok3 n/a
2 TRCN0000280509 CCAAGCATGATGAAGTAGTAT pLKO_005 3177 3UTR 100% 5.625 3.938 N Riok3 n/a
3 TRCN0000023869 CGGCAGACAATGAAGCTGATT pLKO.1 4238 3UTR 100% 4.950 3.465 N Riok3 n/a
4 TRCN0000023870 GCCTACTATCAGACTCTTCAT pLKO.1 3970 3UTR 100% 4.950 3.465 N Riok3 n/a
5 TRCN0000280570 GCCTACTATCAGACTCTTCAT pLKO_005 3970 3UTR 100% 4.950 3.465 N Riok3 n/a
6 TRCN0000023873 GCCTCGTTTCTGAAAGATGAT pLKO.1 4327 3UTR 100% 4.950 3.465 N Riok3 n/a
7 TRCN0000280569 GCCTCGTTTCTGAAAGATGAT pLKO_005 4327 3UTR 100% 4.950 3.465 N Riok3 n/a
8 TRCN0000196572 GTAAACTAAATCCACGTAAGA pLKO.1 3767 3UTR 100% 4.950 3.465 N RIOK3 n/a
9 TRCN0000023872 GCTCAGATGCTACAGATGGAA pLKO.1 2927 3UTR 100% 3.000 2.100 N Riok3 n/a
10 TRCN0000297868 GCTCAGATGCTACAGATGGAA pLKO_005 2927 3UTR 100% 3.000 2.100 N Riok3 n/a
11 TRCN0000194900 CTGTTGTCTTTCATGCATATG pLKO.1 3474 3UTR 100% 0.000 0.000 N RIOK3 n/a
12 TRCN0000342726 CTGTTGTCTTTCATGCATATG pLKO_005 3474 3UTR 100% 0.000 0.000 N RIOK3 n/a
13 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 303 3UTR 100% 4.950 2.475 Y Gad2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782390.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491376 TTAACGGTAGTAGCGGATTGGAGG pLX_317 13.9% 24.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14912 pDONR223 100% 24.2% None (many diffs) n/a
3 ccsbBroad304_14912 pLX_304 0% 24.2% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000472931 GTTAGGCGCCTACCGCCTGCTCTA pLX_317 27.2% 24.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV