Transcript: Mouse XR_001782861.1

PREDICTED: Mus musculus splicing factor U2AF 65 kDa subunit (LOC102640468), misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
LOC102640468 (102640468)
Length:
3956
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782861.1
NBCI Gene record:
LOC102640468 (102640468)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782861.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294694 GAAGAAGAAGGTGCGTAAATA pLKO_005 2136 3UTR 100% 15.000 7.500 Y U2af2 n/a
2 TRCN0000109098 CCTAAATGATGACCAGGTAAA pLKO.1 2691 3UTR 100% 10.800 5.400 Y U2af2 n/a
3 TRCN0000031984 CCCTTACTATGTTTACAACAT pLKO.1 606 3UTR 100% 4.950 2.475 Y Psmb1 n/a
4 TRCN0000324775 CCCTTACTATGTTTACAACAT pLKO_005 606 3UTR 100% 4.950 2.475 Y Psmb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782861.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000479556 ACGAAAGCCTCATCTGGTGCATAC pLX_317 20.7% 30.7% V5 (many diffs) n/a
2 ccsbBroadEn_07799 pDONR223 100% 30.7% None (many diffs) n/a
3 ccsbBroad304_07799 pLX_304 0% 30.7% V5 (many diffs) n/a
Download CSV