Transcript: Mouse XR_001783696.2

PREDICTED: Mus musculus TBC1 domain containing kinase (Tbck), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Tbck (271981)
Length:
6658
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001783696.2
NBCI Gene record:
Tbck (271981)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001783696.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362290 GGATCGGAAGGGCCATATTAA pLKO_005 682 3UTR 100% 15.000 21.000 N Tbck n/a
2 TRCN0000362291 TATCAGCTCAACAGGATTATT pLKO_005 1619 3UTR 100% 15.000 10.500 N Tbck n/a
3 TRCN0000222238 GCCATATTAAACTGGCTAAAT pLKO.1 693 3UTR 100% 13.200 9.240 N Tbck n/a
4 TRCN0000222240 GCTGTGTAGATGATACTATAA pLKO.1 969 3UTR 100% 13.200 9.240 N Tbck n/a
5 TRCN0000222239 CCTCCACTTATGAGAGGTTTA pLKO.1 1712 3UTR 100% 10.800 7.560 N Tbck n/a
6 TRCN0000222242 CCCTTGGTTTCTCACCATGTT pLKO.1 2316 3UTR 100% 4.950 3.465 N Tbck n/a
7 TRCN0000222241 CCTGTATAACTTCTTCTTGAA pLKO.1 2041 3UTR 100% 4.950 3.465 N Tbck n/a
8 TRCN0000362368 GTATGGTCTCTTGGGATAATT pLKO_005 869 3UTR 100% 15.000 9.000 N Tbck n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001783696.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04607 pDONR223 100% 34.2% None (many diffs) n/a
2 ccsbBroad304_04607 pLX_304 0% 34.2% V5 (many diffs) n/a
3 TRCN0000465987 CAAGAGCCGTGAGACGTTCAGATC pLX_317 15.4% 34.2% V5 (many diffs) n/a
4 ccsbBroadEn_04606 pDONR223 100% 33.3% None (many diffs) n/a
5 ccsbBroad304_04606 pLX_304 0% 33.3% V5 (many diffs) n/a
6 TRCN0000480238 GGGTTTGGCTTAGTACCATGTGCC pLX_317 17.7% 33.3% V5 (many diffs) n/a
7 ccsbBroadEn_15218 pDONR223 0% 33.3% None (many diffs) n/a
8 ccsbBroad304_15218 pLX_304 0% 33.3% V5 (many diffs) n/a
Download CSV