Transcript: Mouse XR_001783761.1

PREDICTED: Mus musculus CREB regulated transcription coactivator 2 (Crtc2), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Crtc2 (74343)
Length:
2886
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001783761.1
NBCI Gene record:
Crtc2 (74343)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001783761.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176130 GATGCTAAAGTCCCTGCTATT pLKO.1 869 3UTR 100% 10.800 8.640 N Crtc2 n/a
2 TRCN0000297307 GATGCTAAAGTCCCTGCTATT pLKO_005 869 3UTR 100% 10.800 8.640 N Crtc2 n/a
3 TRCN0000173578 GCTTATACAAGGAGCTCCCAT pLKO.1 416 3UTR 100% 2.640 2.112 N Crtc2 n/a
4 TRCN0000297698 AGCAAGGTGTAGAGGGAAATC pLKO_005 2722 3UTR 100% 10.800 7.560 N Crtc2 n/a
5 TRCN0000176098 GACCCATACTATGACCCATTT pLKO.1 1171 3UTR 100% 10.800 7.560 N Crtc2 n/a
6 TRCN0000279548 GACCCATACTATGACCCATTT pLKO_005 1171 3UTR 100% 10.800 7.560 N Crtc2 n/a
7 TRCN0000193657 CAAGGTGTAGAGGGAAATCTT pLKO.1 2724 3UTR 100% 5.625 3.938 N Crtc2 n/a
8 TRCN0000193797 CCACATTGACAGTTCTCCATA pLKO.1 607 3UTR 100% 4.950 3.465 N Crtc2 n/a
9 TRCN0000194340 CCACCGCCCAATAAATGACTT pLKO.1 1876 3UTR 100% 4.950 3.465 N Crtc2 n/a
10 TRCN0000173279 GAGGACTCATTCCGTAGTGAT pLKO.1 2429 3UTR 100% 4.950 3.465 N Crtc2 n/a
11 TRCN0000279593 GAGGACTCATTCCGTAGTGAT pLKO_005 2429 3UTR 100% 4.950 3.465 N Crtc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001783761.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09804 pDONR223 100% 64.7% None (many diffs) n/a
2 ccsbBroad304_09804 pLX_304 0% 64.7% V5 (many diffs) n/a
3 TRCN0000478076 ATCGTATTCAACCATGAACAGTCC pLX_317 15.3% 64.7% V5 (many diffs) n/a
Download CSV