Transcript: Mouse XR_001785108.1

PREDICTED: Mus musculus peroxisome proliferator activated receptor gamma (Pparg), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pparg (19016)
Length:
2101
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001785108.1
NBCI Gene record:
Pparg (19016)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001785108.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001659 CCTGGTTTCATTAACCTTGAT pLKO.1 1479 3UTR 100% 4.950 6.930 N Pparg n/a
2 TRCN0000001658 GCCCTTTACCACAGTTGATTT pLKO.1 565 3UTR 100% 13.200 9.240 N Pparg n/a
3 TRCN0000321126 GCCCTTTACCACAGTTGATTT pLKO_005 565 3UTR 100% 13.200 9.240 N Pparg n/a
4 TRCN0000001657 GCCCTGGCAAAGCATTTGTAT pLKO.1 1206 3UTR 100% 5.625 3.938 N Pparg n/a
5 TRCN0000321197 GCCCTGGCAAAGCATTTGTAT pLKO_005 1206 3UTR 100% 5.625 3.938 N Pparg n/a
6 TRCN0000001656 GCCTCCCTGATGAATAAAGAT pLKO.1 1560 3UTR 100% 5.625 3.938 N Pparg n/a
7 TRCN0000321198 GCCTCCCTGATGAATAAAGAT pLKO_005 1560 3UTR 100% 5.625 3.938 N Pparg n/a
8 TRCN0000001660 GCTCCACACTATGAAGACATT pLKO.1 599 3UTR 100% 4.950 3.465 N Pparg n/a
9 TRCN0000321127 GCTCCACACTATGAAGACATT pLKO_005 599 3UTR 100% 4.950 3.465 N Pparg n/a
10 TRCN0000001672 GAGATCACAGAGTATGCCAAA pLKO.1 1452 3UTR 100% 4.050 2.835 N PPARG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001785108.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488879 GCAATGGCGCTCTCAGACGTAGTC pLX_317 20.4% 64.9% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489541 AAAGCGGGAAGACGTATTGCCAGG pLX_317 22.5% 64.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_01249 pDONR223 100% 61.7% None (many diffs) n/a
4 TRCN0000481296 GTATAACGCCGGAGATCCACGACA pLX_317 29.5% 61.7% V5 (many diffs) n/a
5 ccsbBroad304_01249 pLX_304 45.7% 61.6% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000488857 GGCTGTCCTGGAAACAGACATATG pLX_317 25.8% 61.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV