Transcript: Human XR_002956771.1

PREDICTED: Homo sapiens KN motif and ankyrin repeat domains 1 (KANK1), transcript variant X16, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KANK1 (23189)
Length:
5966
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002956771.1
NBCI Gene record:
KANK1 (23189)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002956771.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376581 ATGACCGGGAGATGACTAAAC pLKO_005 2274 3UTR 100% 10.800 15.120 N KANK1 n/a
2 TRCN0000365176 GATACTGAATGTATACGTATT pLKO_005 5165 3UTR 100% 10.800 15.120 N KANK1 n/a
3 TRCN0000370223 CCCACTCCAACTTCGAGATTG pLKO_005 4550 3UTR 100% 10.800 8.640 N KANK1 n/a
4 TRCN0000149926 GCAGACCATAGAATCCTTGAA pLKO.1 2209 3UTR 100% 4.950 3.960 N KANK1 n/a
5 TRCN0000365233 GACTTAGATTTCCTCAAATAT pLKO_005 956 3UTR 100% 15.000 10.500 N KANK1 n/a
6 TRCN0000365177 CATCTGGTCAGCAAGGTATAT pLKO_005 1068 3UTR 100% 13.200 9.240 N KANK1 n/a
7 TRCN0000146612 CAGAATGGATACCAAGGTAAT pLKO.1 1469 3UTR 100% 10.800 7.560 N KANK1 n/a
8 TRCN0000148669 CCAGGTAAAGATCTCTGTCTT pLKO.1 1693 3UTR 100% 4.950 3.465 N KANK1 n/a
9 TRCN0000149639 GCTCAGATGAAAGCTCTTCTT pLKO.1 3867 3UTR 100% 4.950 3.465 N KANK1 n/a
10 TRCN0000370224 GTATGCAAATAGCCCTTTATT pLKO_005 5100 3UTR 100% 15.000 9.000 N KANK1 n/a
11 TRCN0000376582 ATCAGCACCCTGTCGTCTATC pLKO_005 3431 3UTR 100% 10.800 6.480 N KANK1 n/a
12 TRCN0000099587 CCTCAAATATGTGGATGACAT pLKO.1 967 3UTR 100% 4.950 2.970 N Kank4 n/a
13 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 4255 3UTR 100% 4.950 2.475 Y CFLAR n/a
14 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 4255 3UTR 100% 4.950 2.475 Y C19orf31 n/a
15 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 4253 3UTR 100% 4.950 2.475 Y ERN2 n/a
16 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 4253 3UTR 100% 4.950 2.475 Y P3H4 n/a
17 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 4253 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002956771.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07849 pDONR223 100% 67.9% None (many diffs) n/a
2 ccsbBroad304_07849 pLX_304 0% 67.9% V5 (many diffs) n/a
3 TRCN0000475877 CAACATAGTTAAGCAATTATTCAA pLX_317 8.7% 67.9% V5 (many diffs) n/a
Download CSV