Transcript: Human XR_002957300.1

PREDICTED: Homo sapiens coatomer protein complex subunit zeta 1 (COPZ1), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COPZ1 (22818)
Length:
3484
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957300.1
NBCI Gene record:
COPZ1 (22818)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957300.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065002 GCAGTATAGATCTCTATTTCT pLKO.1 267 3UTR 100% 5.625 7.875 N COPZ1 n/a
2 TRCN0000298994 GCAGTATAGATCTCTATTTCT pLKO_005 267 3UTR 100% 5.625 7.875 N COPZ1 n/a
3 TRCN0000380555 GTAGCTACACTTCAGATTAAA pLKO_005 2478 3UTR 100% 15.000 12.000 N COPZ1 n/a
4 TRCN0000379566 GTAAAGCTCCCAGCATATTTA pLKO_005 2359 3UTR 100% 15.000 10.500 N COPZ1 n/a
5 TRCN0000064998 CCATCGGACTGACAGTGAAAT pLKO.1 211 3UTR 100% 13.200 9.240 N COPZ1 n/a
6 TRCN0000298990 CCATCGGACTGACAGTGAAAT pLKO_005 211 3UTR 100% 13.200 9.240 N COPZ1 n/a
7 TRCN0000100681 GCCATCCTGATTCTGGACAAT pLKO.1 98 3UTR 100% 4.950 3.465 N Copz1 n/a
8 TRCN0000363778 GCCATCCTGATTCTGGACAAT pLKO_005 98 3UTR 100% 4.950 3.465 N Copz1 n/a
9 TRCN0000065001 GTCAGCCAAAGAACAGATCAA pLKO.1 2118 3UTR 100% 4.950 3.465 N COPZ1 n/a
10 TRCN0000298993 GTCAGCCAAAGAACAGATCAA pLKO_005 2118 3UTR 100% 4.950 3.465 N COPZ1 n/a
11 TRCN0000374707 AGCCAAAGAACAGATCAAGTG pLKO_005 2121 3UTR 100% 4.050 2.835 N Copz1 n/a
12 TRCN0000064999 CTTCGACTCATTGAGCCAGAT pLKO.1 346 3UTR 100% 4.050 2.835 N COPZ1 n/a
13 TRCN0000299062 CTTCGACTCATTGAGCCAGAT pLKO_005 346 3UTR 100% 4.050 2.835 N COPZ1 n/a
14 TRCN0000065000 CCTGTATACTGTCAAAGCCAT pLKO.1 82 3UTR 100% 2.640 1.848 N COPZ1 n/a
15 TRCN0000298991 CCTGTATACTGTCAAAGCCAT pLKO_005 82 3UTR 100% 2.640 1.848 N COPZ1 n/a
16 TRCN0000381033 TGCTCCCTTGCCCTGACATTT pLKO_005 2434 3UTR 100% 13.200 7.920 N COPZ1 n/a
17 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 927 3UTR 100% 4.950 2.475 Y CFLAR n/a
18 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 927 3UTR 100% 4.950 2.475 Y C19orf31 n/a
19 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 1003 3UTR 100% 4.950 2.475 Y ORAI2 n/a
20 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 993 3UTR 100% 13.200 6.600 Y IQCC n/a
21 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 1000 3UTR 100% 4.950 2.475 Y LOC339059 n/a
22 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 925 3UTR 100% 4.950 2.475 Y ERN2 n/a
23 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 925 3UTR 100% 4.950 2.475 Y P3H4 n/a
24 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 925 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957300.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02686 pDONR223 100% 14.7% None (many diffs) n/a
2 ccsbBroad304_02686 pLX_304 0% 14.7% V5 (many diffs) n/a
3 TRCN0000466412 AAACCCCAGAACTGAAAACCACAG pLX_317 74.5% 14.7% V5 (many diffs) n/a
Download CSV