Transcript: Human XR_002958019.1

PREDICTED: Homo sapiens solute carrier family 25 member 39 (SLC25A39), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC25A39 (51629)
Length:
2622
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002958019.1
NBCI Gene record:
SLC25A39 (51629)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002958019.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276158 TCTACCCTTTGACGTGGTAAA pLKO_005 1987 3UTR 100% 10.800 15.120 N SLC25A39 n/a
2 TRCN0000276092 CTGGAGCTTATGCGGACAAAG pLKO_005 1822 3UTR 100% 10.800 7.560 N SLC25A39 n/a
3 TRCN0000158505 CCAAGTTCAAGACCAAATCTT pLKO.1 2472 3UTR 100% 5.625 3.938 N SLC25A39 n/a
4 TRCN0000162535 CCCAAGTTCAAGACCAAATCT pLKO.1 2471 3UTR 100% 5.625 3.938 N SLC25A39 n/a
5 TRCN0000276093 CCCAAGTTCAAGACCAAATCT pLKO_005 2471 3UTR 100% 5.625 3.938 N SLC25A39 n/a
6 TRCN0000164300 CTTCCTTCCTCGGATCATCAA pLKO.1 2134 3UTR 100% 4.950 3.465 N SLC25A39 n/a
7 TRCN0000162889 GCACTTCCTCAGACACAACTT pLKO.1 2408 3UTR 100% 4.950 3.465 N SLC25A39 n/a
8 TRCN0000276091 GCACTTCCTCAGACACAACTT pLKO_005 2408 3UTR 100% 4.950 3.465 N SLC25A39 n/a
9 TRCN0000163529 GCCATCTACTTCACTGCCTAT pLKO.1 1693 3UTR 100% 4.050 2.835 N SLC25A39 n/a
10 TRCN0000162775 CCTCAGACACAACTTCTTCCT pLKO.1 2414 3UTR 100% 2.640 1.848 N SLC25A39 n/a
11 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 997 3UTR 100% 4.950 2.475 Y ORAI2 n/a
12 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 994 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002958019.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08332 pDONR223 100% 34.4% None (many diffs) n/a
2 ccsbBroad304_08332 pLX_304 0% 34.4% V5 (many diffs) n/a
3 TRCN0000467005 TCACATAAATCGCGGGAGCTGACA pLX_317 37.6% 34.4% V5 (many diffs) n/a
4 ccsbBroadEn_15070 pDONR223 71.4% 34.2% None (many diffs) n/a
5 ccsbBroad304_15070 pLX_304 0% 34.2% V5 (many diffs) n/a
6 TRCN0000468814 TATTCTCATTTCATTCAAAGCAAT pLX_317 37.3% 34.2% V5 (many diffs) n/a
Download CSV